Commit 7e42cd5e authored by Alessandro Vullo's avatar Alessandro Vullo
Browse files

[ENSCORESW-2387] Test suite and data, partial but functional.

parent bd9c122f
# This provides a default set of configurations which is merged with your
# provided MultiTestDB.conf.
#
# You should provide a MultiTestDB.conf which defines the databases
{
'databases' => {
'homo_sapiens' => {
'core' => 'Bio::EnsEMBL::DBSQL::DBAdaptor',
},
'mus_musculus' => {
'core' => 'Bio::EnsEMBL::DBSQL::DBAdaptor',
},
'multi' => {
'compara' => 'Bio::EnsEMBL::Compara::DBSQL::DBAdaptor',
},
},
}
# Copyright [1999-2015] Wellcome Trust Sanger Institute and the EMBL-European Bioinformatics Institute
# Copyright [2016-2017] EMBL-European Bioinformatics Institute
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
use strict;
use Test::More;
use Test::Warnings;
use Bio::EnsEMBL::Test::MultiTestDB;
ok(1);
# Database will be dropped when this
# object goes out of scope
my $ens_test = Bio::EnsEMBL::Test::MultiTestDB->new;
ok($ens_test);
my $dba = $ens_test->get_DBAdaptor("core");
ok($dba);
my $sth = $dba->dbc->prepare("select * from gene");
$sth->execute;
ok(scalar(@{$sth->fetchall_arrayref}) == 21, "Check gene count to prove table has data");
# now hide the gene table i.e. make an empty version of it
$ens_test->hide("core","gene");
$sth->execute;
ok(scalar(@{$sth->fetchall_arrayref}) == 0, "Check table is empty after hiding");
# restore the gene table
$ens_test->restore();
$sth->execute;
ok(scalar(@{$sth->fetchall_arrayref}) == 21, "Check table repopulated after restore");
# now save the gene table i.e. make a copy of it
$ens_test->save("core","gene");
$sth->execute;
ok(scalar(@{$sth->fetchall_arrayref}) == 21, "Check content still correct after save");
# delete 9 genes from the db
$sth = $dba->dbc->prepare("delete from gene where gene_id >= 18266");
$sth->execute;
$sth = $dba->dbc->prepare("select * from gene");
$sth->execute;
ok(scalar(@{$sth->fetchall_arrayref}) == 10,"Check results of deleting genes");
# check to see whether the restore works again
$ens_test->restore();
$sth->execute;
ok(scalar(@{$sth->fetchall_arrayref}) == 21);
$sth->finish;
done_testing();
This diff is collapsed.
1 2000-09-08 16:10:03 RepeatMask repbase 001212 RepeatMasker 1 RepeatMasker 1 RepeatMasker repeat
2 2000-09-22 10:59:05 Genscan HumanIso.smat 1 HumanIso.smat genscan 1.0 Genscan 1 genscan prediction
5 2000-09-28 17:33:27 Swall swall 1 swall wublastp 1 -hitdist=40, -cpus=1 BlastGenscanPep wublastp similarity
7 2000-10-09 15:30:14 Vertrna embl_vertrna 1 embl_vertrna wutblastn 1 -hitdist=40, -cpus=1 BlastGenscanDNA 1 wutblastn similarity
4 2000-12-18 15:12:30 tRNAscan tRNA 1 tRNAscan-SE 1.11 tRNAscan_SE 1 tRNAscan-SE tRNA
8 2000-12-18 18:28:03 CpG cpg 1 cpg 1 CPG 1 cpg cpg_island
9 2001-01-15 17:00:00 Unigene unigene.seq 1 unigene.seq wutblastn 1 -hitdist=40, -cpus=1 BlastGenscanDNA 1 wutblastn similarity
10 2001-01-15 17:00:00 QTL 1 1 QtlPlacer 1 experimental marker
12 2001-03-28 16:42:32 dbEST dbEST 1 dbEST wutblastn 1 -hitdist=40, -cpus=1 BlastGenscanDNA 1 wutblastn similarity
6 2001-09-04 17:21:19 Eponine NULL NULL NULL eponine-scan 1 /usr/opt/java131/bin/java -epojar => /usr/local/ensembl/lib/eponine-scan.jar, -threshold => 0.999 VC_EponineTSS 1 Eponine TSS
54 2002-08-12 14:52:26 human_swall_protein 1 TGE_gw 1 TargettedGeneWise TGE_gw gene
53 2002-08-12 14:52:26 human_refseq_protein 1 TGE_gw 1 TargettedGeneWise TGE_gw gene
1280 2002-08-12 14:52:26 other_swall_protein 1 similarity_genewise 1 FPC_BlastMiniGenewise similarity_genewise gene
1281 2002-08-12 14:52:26 combined-protein_cdna 1 combined_gw_e2g 1 Combine_Genewises_and_E2Gs combined_gw_e2g gene
1282 2002-08-12 14:52:26 ensembl 1 ensembl 1 Gene_Builder ensembl gene
1290 2002-08-12 14:52:26 refseq_cdna human_mRNA 1 exonerate_e2g 1 FilterESTs_and_E2G exonerate gene
1291 2002-08-12 14:52:26 embl_vertrna human_mRNA 1 exonerate_e2g 1 FilterESTs_and_E2G exonerate gene
49 \N Pfam Pfam 1 /data/blastdb/Ensembl/Pfam_ls;/data/blastdb/Ensembl/Pfam_fs /nfs/farm/Worms/bin/hmmpfam 1 /nfs/farm/Worms/bin/hmmpfam Pfam 1 PFAM domain
40 \N prints prints NULL /acari/analysis/iprscan/data/prints.pval /acari/analysis/iprscan/bin/OSF1/FingerPRINTScan NULL /acari/analysis/iprscan/bin/OSF1/FingerPRINTScan NULL Prints NULL PRINTS domain
41 \N pfscan pfscan NULL /acari/analysis/iprscan/data/prosite_prerelease.prf /acari/analysis/iprscan/bin/OSF1/pfscan NULL /acari/analysis/iprscan/bin/OSF1/pfscan NULL Profile NULL PROFILE domain
43 \N Signalp signal_peptide NULL NULL /usr/local/ensembl/bin/signalp NULL /usr/local/ensembl/bin/signalp NULL Signalp NULL Signalp annot
46 \N tmhmm transmembrane NULL NULL /acari/work1/mongin/src/pipeline4anopheles/scripts/protein_pipeline/run_tmhmm NULL /acari/work1/mongin/src/pipeline4anopheles/scripts/protein_pipeline/run_tmhmm NULL Tmhmm NULL Tmhmm annot
45 \N ncoils coiled_coil NULL NULL /usr/local/ensembl/bin/ncoils NULL /usr/local/ensembl/bin/ncoils NULL ncoils NULL ncoils annot
44 \N Seg low_complexity NULL NULL /usr/local/ensembl/bin/seg NULL /usr/local/ensembl/bin/seg NULL Seg NULL Seg annot
42 \N scanprosite prosite NULL /acari/analysis/iprscan/data/prosite.patterns /acari/analysis/iprscan/bin/scanregexpf.pl /acari/analysis/iprscan/data/confirm.pat /acari/analysis/iprscan/bin/scanregexpf.pl Prosite NULL PROSITE domain
71 \N Superfamily Superfamily 1 /data/blastdb/Ensembl/sam/superfamily /acari/work1/mongin/superfamily/superfamily.pl 1 /acari/work1/mongin/superfamily/superfamily.pl Superfamily 1 Superfamily annot
1292 \N SNPDensity \N \N \N \N \N \N \N \N \N \N \N
1293 \N RepeatCoverage \N \N \N \N \N \N \N \N \N \N \N
1500 \N miRanda \N \N \N \N \N \N \N \N \N \N \N
1501 \N cisred \N \N \N \N \N \N \N \N \N \N \N
1502 \N cisred_search \N \N \N \N \N \N \N \N \N \N \N
1503 \N DitagAlign \N \N \N \N \N \N \N \N \N \N \N
8405 2009-05-14 15:43:42 havana NULL NULL NULL NULL NULL NULL NULL NULL NULL NULL NULL
8406 2009-06-01 09:01:22 xrefexoneratedna NULL NULL NULL NULL NULL NULL NULL NULL NULL NULL NULL
8407 2007-09-07 12:01:22 est2genome_human_havana NULL 10-Nov-10 (105) NULL NULL NULL NULL ori_analysis => Est2genome_human_raw, mode => single ClusterDepthFilter NULL EST_Human similarity
8408 2007-09-07 12:01:22 uniprot_sw_havana NULL 2010_11 NULL NULL NULL NULL percentid_cutoff => 40, ori_analysis => Uniprot_raw, hit_db => Swissprot, mode => single DepthFilter NULL SwissProt NULL
1282 Genes were annotated by the Ensembl automatic analysis pipeline using either a GeneWise model from a human/vertebrate protein, a set of aligned human cDNAs followed by GenomeWise for ORF prediction or from Genscan exons supported by protein, cDNA and EST evidence. GeneWise models are further combined with available aligned cDNAs to annotate UTRs. ensembl transcript 1 web data 1 0 \N
1503 new description new label 0 0 \N
1504 updated description N 0 0 \N
8405 Manual annotation (determined on a case-by-case basis) from the <a rel="external" href="http://www.sanger.ac.uk/HGP/havana/havana.shtml">Havana</a> project. Havana 1 {'multi_name' => 'Ensembl genes, or Merged Ensembl and Havana genes','colour_key' => '[biotype]','caption' => 'Genes (Merged Ensembl/Havana) (GENCODE)','name' => 'Merged Ensembl and Havana genes (GENCODE)','label_key' => '[biotype]','default' => {'MultiTop' => 'gene_label','contigviewbottom' => 'transcript_label','MultiBottom' => 'collapsed_label','contigviewtop' => 'gene_label','cytoview' => 'gene_label','alignsliceviewbottom' => 'as_collapsed_label'},'key' => 'ensembl'}
8406 Sequences from various databases are matched to Ensembl transcripts using <a rel="external" href="http://www.biomedcentral.com/1471-2105/6/31">Exonerate</a>. These are external references, or 'Xrefs'. DNA match 0 \N
8407 Alignment of human ESTs (expressed sequence tags) to the genome using the program <a rel="external" href="http://emboss.sourceforge.net/apps/cvs/emboss/apps/est2genome.html">Est2genome</a>. ESTs are from <a rel="external" href="http://www.ncbi.nlm.nih.gov/dbEST/">dbEST</a> Human EST (EST2genome) 0 {'type' => 'est'}
8408 Proteins from the <a rel="external" href="http://uniprot.org">UniProtKB Swiss-Prot</a> database, aligned to the genome by Havana. UniProt proteins 0 \N
469271 965905 1 200 10 209 1
469271 965905 201 400 401 600 -1
469282 965905 1 100 701 800 -1
469283 317101 30263615 30426490 101 162976 1
469283 317332 30811187 30929959 101 118873 1
469283 317348 31086734 31205532 101 118899 1
469283 317523 30451401 30562994 101 111694 1
469283 318770 30726577 30811186 101 84710 1
469283 319047 30562995 30708200 101 145306 1
469283 319456 30993469 31086733 101 93365 1
469283 339816 30426491 30451400 101 25010 1
469283 345105 30708201 30726576 1 18376 1
469283 368744 30249935 30263614 101 13780 1
469283 376992 31205533 31254640 101 49208 1
469283 469270 30929960 30993468 101 63609 1
469332 317348 1 118899 1 118899 1
469333 317523 1 111694 1 111694 1
469334 317101 1 162976 1 162976 1
469335 319456 1 93365 1 93365 1
469336 345105 1 18376 1 18376 1
469337 317332 1 118873 1 118873 1
469338 368744 1 13780 1 13780 1
469339 318770 1 84710 1 84710 1
469340 339816 1 25010 1 25010 1
469341 376992 1 49208 1 49208 1
469342 319047 1 145414 1 145414 1
469343 469270 1 63609 1 63609 1
469348 317101 671650 834525 101 162976 1
469348 317332 1219222 1337994 101 118873 1
469348 317348 1494769 1613567 101 118899 1
469348 317523 859436 971029 101 111694 1
469348 318770 1134612 1219221 101 84710 1
469348 319047 971030 1116235 101 145306 1
469348 319456 1401504 1494768 101 93365 1
469348 339816 834526 859435 101 25010 1
469348 345105 1116236 1134611 1 18376 1
469348 368744 657970 671649 101 13780 1
469348 376992 1613568 1662675 101 49208 1
469348 469270 1337995 1401503 101 63609 1
965899 965888 1 16571 1 16571 1
965906 469283 100 396 31210077 31210373 1
965906 469283 397 562 31214121 31214286 1
965906 469283 563 3444 31222465 31225346 1
1 469294 10000000 10500000 PAR 469283 30300000 30800000 1
2 469351 30500000 30599999 HAP 469283 30500000 30699999 1
1 synonym Alternate names for clone Synonyms
2 FISHmap FISH information FISH map
3 organisation Organisation sequencing clone
4 state Current state of clone
5 BACend_flag BAC end flags
6 embl_acc EMBL accession number
7 superctg Super contig id.
8 seq_len Accession length
9 fp_size FP size
10 note Note
11 positioned_by Positioned by
12 bac_acc BAC end accession
13 htg_phase HTG Phase High Throughput Genome Phase
14 toplevel Top Level Top Level Non-Redundant Sequence Region
15 _rna_edit RNA editing \N
16 _selenocysteine Selenocysteine \N
17 codon_table Codon Table Alternate codon table
18 non_ref Non Reference Non Reference Sequence Region
19 karyotype_rank Rank in the karyotype For a given seq_region, if it is part of the species karyotype, will indicate its rank
20 proj_parent_g projection parent gene Stable identifier of the parent gene this gene was projected from (projection between different species and/or assemblies).
21 proj_parent_t projection parent transcript Stable identifier of the parent transcript this transcript was projected from (projection between different species and/or assemblies).
1 1 chromosome NCBI33 1 default_version
2 1 supercontig \N 2 default_version
3 1 clone \N 3 default_version
4 1 contig \N 4 default_version,sequence_level
6 1 chunk \N 5 default_version
7 1 alt_chrom \N 6 default_version
1 1 469283 1 100 50.30
2 1 469283 101 200 68.80
3 1 469283 201 300 32.00
4 1 469283 301 400 90.90
5 1 469283 401 500 88.80
6 1 469283 501 600 12.00
7 2 469283 1 100 50.30
8 2 469283 101 200 68.80
9 2 469283 201 300 32.00
10 2 469283 301 400 90.90
11 2 469283 401 500 88.80
12 2 469283 501 600 12.00
3278356 162B08-6 ZZ13 1 GAAGCAAAACACTACAATGGCGGTGCGCTCGACGCGCC
3278355 198K08-11 ZZ13 1 TTTGATAATTTATTTCAGGCTCTGCGAGAATGAACTC
3278354 137M14-9 ZZ13 1 GCCTGTTAGATTCACCCCGGTCTCGAGTCTCTCTCTC
3278353 201K11-2 ZZ13 1 CCTTGAAATTAAGAAGAAGGGCTCGCCGCCGCCGCAC
3278352 151H04-2 ZZ13 1 GTTCAGTATGGTTTTCAAGAGGGTTAATTGAAAGAG
3278351 119K09-6 ZZ13 2 TGGAATCTCCATTATTATGAGCGCGCCGCCCCACTCC
3278350 187N08-1 ZZ13 1 GGAGGTGGATGAGAGGCCAACTCCAGCTCTCTCTCT
3278349 211G12-2 ZZ13 1 GGGCTGCGATTGCAGCTCACCCTTCGTTAGATAATCA
3278348 181D04-4 ZZ13 4 TTCTTTCTTTTTTAAAGGGGGTCACGGTCGCCAAACC
3278347 213E17-4 ZZ13 1 ACATGGGAGACATTTTGCCAAGGCAGCATCAAAAAAC
3278346 112H10-9 ZZ13 2 AGAGAGAGCTGGAGTTTTGGTAAGAGCATCCTAAGC
3278345 229D11-1 ZZ13 1 GGCTGGGATAGAGGAGGACGTCTCGAGTCTCTCTCTC
3278344 235I06-3 ZZ13 1 CGAGAAAAGGAGAGGAGCCTGCTGCCTCCGCCAGAC
3278343 191F14-10 ZZ13 1 TCCAGCTGCATGAGCAAGGGCCGGGGGCGCGTCAGACC
3278342 188P19-10 ZZ13 2 ATGGTTATGAGCTGCTCTGCGAGCGCGCGAGTGAGCA
3278341 224L18-4 ZZ13 1 GTGGCTCCAGGCATCCAGCATAAAATACATGTCTCAA
3278340 156G19-5 ZZ13 3 GAGAGAGCTGGAGTTTTTACGGAAGCTGCTGCCGCCC
3278339 189F08-4 ZZ13 1 CACGGCAATTCCTAGGTCCCGAGCGGAATAACAGGCCC
3278338 134O12-6 ZZ13 1 GGAGACTGCTGGGAGTCCTAAACTCCAGCTCTCTCTCT
3278337 219H13-10 ZZ13 1 TGCAGCCGCCCATCAAGAATGGGCTCTGGAGGCAGACC
4828567 3278337 1 469273 120635196 120635214 1 1503 1 19 1 19M L
4828568 3278337 1 469273 120640125 120640142 1 1503 20 37 1 18M R
4828699 3278342 1 469288 78423526 78423543 1 1503 1 18 1 18M L
4828700 3278342 1 469288 78482803 78482821 1 1503 19 37 1 19M R
4828469 3278343 1 469271 75028243 75028261 -1 1503 1 19 1 19M L
4828470 3278343 1 469271 75026001 75026018 -1 1503 20 37 1 18M R
4828725 3278346 1 469273 98254679 98254696 1 1503 1 18 1 18M L
4828726 3278346 1 469273 97923747 97923763 1 1503 20 36 1 17M R
4828557 3278347 1 469275 100525017 100525035 -1 1503 1 19 1 19M L
4828558 3278347 1 469275 100522073 100522091 -1 1503 19 37 1 19M R
4828761 3278348 1 469288 111529629 111529647 -1 1503 1 19 1 19M L
4828762 3278348 1 469288 111528958 111528976 -1 1503 19 37 1 19M R
4828459 3278351 1 469273 83236330 83236347 -1 1503 1 18 1 18M L
4828460 3278351 1 469273 83225874 83225891 -1 1503 19 36 1 18M R
4828401 3278355 1 469275 24825423 24825440 1 1503 1 18 1 18M L
4828402 3278355 1 469275 24838796 24838814 1 1503 19 37 1 19M R
4828583 3278356 1 469272 40626355 40626373 -1 1503 1 19 1 19M L
4828584 3278356 1 469272 40572274 40572291 -1 1503 20 37 1 18M R
This diff is collapsed.
161874 469283 30300869 30300924 1 1 0 1 0 ENSE00000991637 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161875 469283 30285705 30285782 1 0 0 1 0 ENSE00000991635 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161876 469283 30284451 30284562 1 2 0 1 0 ENSE00000859878 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161877 469283 30298823 30298904 1 2 0 1 0 ENSE00001180831 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161878 469283 30298823 30298913 1 0 1 1 0 ENSE00000991636 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161879 469283 30296506 30296579 1 0 2 1 0 ENSE00001155786 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161880 469283 30285597 30285782 1 0 0 1 0 ENSE00000661128 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161881 469283 30274334 30274425 1 0 2 1 0 ENSE00001155821 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161882 469283 30295724 30295792 1 0 0 1 1 ENSE00000991632 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161883 469283 30315002 30315126 1 2 1 1 1 ENSE00001155819 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161884 469283 30318805 30318881 1 1 0 1 1 ENSE00001180793 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161885 469283 30301733 30301887 1 0 2 1 1 ENSE00001155773 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161886 469283 30310552 30310748 1 0 2 1 1 ENSE00001048784 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161887 469283 30313256 30313369 1 2 2 1 1 ENSE00001048782 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161888 469283 30309589 30309718 1 2 0 1 1 ENSE00001180789 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161889 469283 30324668 30324742 -1 1 1 1 1 ENSE00000661138 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161890 469283 30327735 30327869 -1 0 0 1 1 ENSE00001155739 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161891 469283 30320853 30321749 -1 1 -1 1 1 ENSE00001109504 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161892 469283 30322356 30322436 -1 1 1 1 1 ENSE00000661137 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161893 469283 30326172 30326247 -1 0 1 1 1 ENSE00000661139 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161894 469283 30371004 30371130 1 0 1 1 1 ENSE00000661141 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161895 469283 30372365 30372906 1 1 0 1 1 ENSE00000661142 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161896 469283 30395173 30395269 1 1 -1 1 0 ENSE00001109529 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161897 469283 30386305 30386344 1 -1 -1 1 0 ENSE00001048790 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161898 469283 30404855 30404984 1 2 0 1 0 ENSE00001155580 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161899 469283 30390764 30390931 1 0 0 1 0 ENSE00000661143 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161900 469283 30406861 30408041 1 1 -1 1 0 ENSE00001155591 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161901 469283 30404855 30404984 1 -1 -1 1 0 ENSE00001155601 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161902 469283 30405560 30405698 1 -1 -1 1 0 ENSE00001180675 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161903 469283 30393660 30393743 1 0 0 1 1 ENSE00000661144 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161904 469283 30401716 30401779 1 1 2 1 0 ENSE00000898445 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161905 469283 30398520 30398655 1 -1 -1 1 0 ENSE00001180687 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161906 469283 30398520 30398655 1 0 1 1 0 ENSE00000661146 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161907 469283 30390764 30390931 1 -1 0 1 0 ENSE00001180716 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161908 469283 30394803 30395269 1 1 0 1 0 ENSE00000898444 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161909 469283 30394803 30394958 1 1 1 1 0 ENSE00001109521 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161910 469283 30393839 30394022 1 0 1 1 1 ENSE00000661145 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161911 469283 30406861 30408041 1 -1 -1 1 0 ENSE00001155622 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161912 469283 30386305 30386344 1 -1 0 1 0 ENSE00001180732 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161913 469283 30405560 30405698 1 0 1 1 0 ENSE00000661148 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161914 469283 30447522 30447642 1 2 0 1 1 ENSE00000661151 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161915 469283 30459754 30459903 1 1 1 1 1 ENSE00000661156 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161916 469283 30464428 30464504 1 1 0 1 1 ENSE00000661159 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161917 469283 30462488 30462667 1 1 1 1 1 ENSE00000661158 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161918 469283 30450483 30450581 1 2 2 1 1 ENSE00000661154 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161919 469283 30460251 30460403 1 1 1 1 1 ENSE00000661157 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161920 469283 30469723 30469876 1 0 1 1 1 ENSE00000661160 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161921 469283 30474864 30474995 1 1 1 1 1 ENSE00000661161 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161922 469283 30449179 30449221 1 0 1 1 1 ENSE00000661152 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161923 469283 30449576 30449678 1 1 2 1 1 ENSE00000661153 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161924 469283 30477177 30477716 1 1 -1 1 1 ENSE00000859897 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161925 469283 30455634 30455737 1 2 1 1 1 ENSE00000661155 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161926 469283 30428114 30428346 1 -1 2 1 1 ENSE00001048792 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161927 469283 30533654 30533829 1 0 2 1 1 ENSE00000661175 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161928 469283 30525494 30525626 1 0 1 1 1 ENSE00000859908 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161929 469283 30537136 30537225 1 0 0 1 1 ENSE00000859917 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161930 469283 30518842 30518965 1 0 1 1 1 ENSE00000661167 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161931 469283 30541155 30543114 1 0 -1 1 1 ENSE00001048793 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161932 469283 30517357 30517525 1 1 2 1 1 ENSE00000859900 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161933 469283 30521172 30521283 1 0 1 1 1 ENSE00000859904 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161934 469283 30535852 30535971 1 0 0 1 1 ENSE00000859916 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161935 469283 30508873 30508986 1 -1 0 1 1 ENSE00000859898 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161936 469283 30511934 30512033 1 0 1 1 1 ENSE00000859899 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161937 469283 30534311 30534374 1 2 0 1 1 ENSE00000859915 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161938 469283 30522645 30522715 1 1 0 1 1 ENSE00000859906 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161939 469283 30530963 30531046 1 0 0 1 1 ENSE00000859913 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161940 469283 30520951 30521069 1 1 0 1 1 ENSE00000661168 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161941 469283 30485596 30485899 1 -1 -1 1 1 ENSE00001048794 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161942 469283 30526660 30526735 1 2 0 1 1 ENSE00000859910 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161943 469283 30526482 30526563 1 1 2 1 1 ENSE00000661172 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161944 469283 30517626 30517755 1 2 0 1 1 ENSE00000661166 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161945 469283 30565065 30566129 -1 0 0 1 1 ENSE00000859919 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161946 469283 30568364 30573542 -1 2 -1 1 1 ENSE00000859920 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161947 469283 30577779 30578152 -1 -1 2 1 1 ENSE00000859921 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161948 469283 30583501 30583588 -1 -1 -1 1 1 ENSE00001048795 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161949 469283 30585931 30586052 1 1 0 1 1 ENSE00001154695 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161950 469283 30592868 30593764 1 2 -1 1 0 ENSE00000991618 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161951 469283 30591129 30591311 1 0 0 1 1 ENSE00000661185 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161952 469283 30592469 30592581 1 0 2 1 1 ENSE00000661188 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161953 469283 30606679 30606921 1 0 0 1 0 ENSE00000661190 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161954 469283 30604123 30604315 1 2 0 1 0 ENSE00000661189 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161955 469283 30583753 30583925 1 -1 1 1 1 ENSE00000991617 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161956 469283 30610333 30614524 1 0 -1 1 0 ENSE00001180460 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161957 469283 30685573 30687041 1 -1 0 1 1 ENSE00001154654 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161958 469283 30692078 30692179 1 0 0 1 1 ENSE00000661193 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161959 469283 30706001 30706179 1 0 2 1 1 ENSE00000661198 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161960 469283 30702631 30702744 1 2 2 1 1 ENSE00000661196 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161961 469283 30653524 30653625 1 -1 -1 1 1 ENSE00001180424 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161962 469283 30703416 30703521 1 2 0 1 1 ENSE00000661197 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161963 469283 30707083 30709209 1 2 -1 1 1 ENSE00001180428 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161964 469283 30692616 30692734 1 0 2 1 1 ENSE00000661195 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161965 469283 30692387 30692509 1 0 0 1 1 ENSE00000661194 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161966 469283 30735607 30735651 1 0 0 1 0 ENSE00001154607 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161967 469283 30810292 30815178 1 0 -1 1 0 ENSE00001154598 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161968 469283 30742244 30742326 1 0 2 1 0 ENSE00001154580 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161969 469283 30807181 30807344 1 1 0 1 1 ENSE00001154547 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161970 469283 30808740 30808845 1 1 2 1 1 ENSE00001154532 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161971 469283 30744875 30744983 1 2 0 1 0 ENSE00001154573 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161972 469283 30809144 30809777 1 2 0 1 1 ENSE00001154526 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161973 469283 30805794 30805913 1 -1 1 1 0 ENSE00001154588 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161974 469283 30810292 30813218 1 0 -1 1 0 ENSE00001180401 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161975 469283 30804185 30804282 1 1 0 1 0 ENSE00001154566 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161976 469283 30807443 30807539 1 0 1 1 1 ENSE00001154539 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161977 469283 30803988 30804108 1 0 1 1 0 ENSE00001154570 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161978 469283 30805761 30805913 1 1 1 1 0 ENSE00001154553 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161979 469283 30805198 30805291 1 0 1 1 0 ENSE00001154561 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161980 469283 30840814 30840977 -1 1 0 1 0 ENSE00000661210 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161981 469283 30828096 30828297 -1 0 1 1 0 ENSE00000661206 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161982 469283 30850461 30850602 -1 0 1 1 0 ENSE00001048819 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161983 469283 30829164 30829355 -1 0 0 1 0 ENSE00000661208 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161984 469283 30859222 30859269 -1 0 0 1 0 ENSE00000859928 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161985 469283 30829436 30829621 -1 0 0 1 0 ENSE00001048813 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161986 469283 30822726 30823676 -1 1 -1 1 0 ENSE00001048811 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161987 469283 30831978 30832255 -1 1 0 1 0 ENSE00001048814 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161988 469283 30850461 30850611 -1 -1 1 1 0 ENSE00000859927 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161989 469283 30828744 30828866 -1 0 0 1 0 ENSE00000560934 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161990 469283 30896671 30896782 -1 0 1 1 1 ENSE00000560920 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161991 469283 30911297 30911383 -1 0 0 1 1 ENSE00000661216 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161992 469283 30887207 30887316 -1 1 0 1 1 ENSE00000560923 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161993 469283 30903618 30903773 -1 0 0 1 1 ENSE00000661215 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161994 469283 30885729 30885800 -1 0 0 1 1 ENSE00000661212 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161995 469283 31070930 31071301 -1 0 0 1 1 ENSE00001180291 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161996 469283 31074431 31074535 -1 0 0 1 1 ENSE00000991593 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161997 469283 31074629 31074682 -1 0 0 1 1 ENSE00000991592 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161998 469283 31089847 31089984 -1 0 0 1 1 ENSE00000991591 1 2004-12-06 12:00:00 2004-12-06 12:00:00
161999 469283 31139165 31139309 1 0 1 1 1 ENSE00000859938 1 2004-12-06 12:00:00 2004-12-06 12:00:00
162000 469283 31126857 31127004 1 -1 1 1 1 ENSE00000859930 1 2004-12-06 12:00:00 2004-12-06 12:00:00
162001 469283 31131297 31131398 1 0 0 1 1 ENSE00000859933 1 2004-12-06 12:00:00 2004-12-06 12:00:00
162002 469283 31147817 31147965 1 1 0 1 1 ENSE00000661233 1 2004-12-06 12:00:00 2004-12-06 12:00:00
162003 469283 31152748 31152866 1 0 2 1 1 ENSE00000859951 1 2004-12-06 12:00:00 2004-12-06 12:00:00
162004 469283 31147374 31147464 1 0 1 1 1 ENSE00000661232 1 2004-12-06 12:00:00 2004-12-06 12:00:00
162005 469283 31133041 31133166 1 0 0 1 1 ENSE00000661220 1 2004-12-06 12:00:00 2004-12-06 12:00:00
162006 469283 31143726 31143838 1 0 2 1 1 ENSE00000859942 1 2004-12-06 12:00:00 2004-12-06 12:00:00
162007 469283 31143329 31143408 1 1 0 1 1 ENSE00000661227 1 2004-12-06 12:00:00 2004-12-06 12:00:00
162008 469283 31127892 31127953 1 1 0 1 1 ENSE00000661218 1 2004-12-06 12:00:00 2004-12-06 12:00:00
162009 469283 31154301 31155894 1 2 -1 1 1 ENSE00001154272 1 2004-12-06 12:00:00 2004-12-06 12:00:00
162010 469283 31146692 31146837 1 1 0 1 1 ENSE00000859946 1 2004-12-06 12:00:00 2004-12-06 12:00:00
162011 469283 31148924 31149009 1 0 2 1 1 ENSE00000661234 1 2004-12-06 12:00:00 2004-12-06 12:00:00
162012 469283 31142189 31142233 1 1 1 1 1 ENSE00000661226 1 2004-12-06 12:00:00 2004-12-06 12:00:00
162013 469283 31140075 31140134 1 1 1 1 1 ENSE00000661225 1 2004-12-06 12:00:00 2004-12-06 12:00:00
162014 469283 31135393 31135551 1 0 0 1 1 ENSE00000661222 1 2004-12-06 12:00:00 2004-12-06 12:00:00
162015 469283 31108924 31109238 1 -1 -1 1 1 ENSE00001154263 1 2004-12-06 12:00:00 2004-12-06 12:00:00
162016 469283 31138140 31138247 1 0 0 1 1 ENSE00000859937 1 2004-12-06 12:00:00 2004-12-06 12:00:00
162017 469283 31141948 31142073 1 1 1 1 1 ENSE00000560951 1 2004-12-06 12:00:00 2004-12-06 12:00:00
162018 469283 31145783 31145867 1 0 1 1 1 ENSE00000661230 1 2004-12-06 12:00:00 2004-12-06 12:00:00
162019 469283 31144999 31145182 1 2 0 1 1 ENSE00000859943 1 2004-12-06 12:00:00 2004-12-06 12:00:00
162020 469283 31133769 31133990 1 0 0 1 1 ENSE00000859935 1 2004-12-06 12:00:00 2004-12-06 12:00:00
162021 469283 31151877 31151946 1 2 0 1 1 ENSE00000661235 1 2004-12-06 12:00:00 2004-12-06 12:00:00
162022 469283 31166507 31166567 1 -1 -1 1 1 ENSE00001048833 1 2004-12-06 12:00:00 2004-12-06 12:00:00
162023 469283 31193157 31193309 1 0 0 1 1 ENSE00000661242 1 2004-12-06 12:00:00 2004-12-06 12:00:00
162024 469283 31183173 31183380 1 0 1 1 1 ENSE00000661240 1 2004-12-06 12:00:00 2004-12-06 12:00:00
162025 469283 31186274 31186395 1 1 0 1 1 ENSE00000661241 1 2004-12-06 12:00:00 2004-12-06 12:00:00
162026 469283 31180256 31180401 1 1 0 1 1 ENSE00000661239 1 2004-12-06 12:00:00 2004-12-06 12:00:00
162027 469283 31172464 31172587 1 -1 1 1 1 ENSE00000859955 1 2004-12-06 12:00:00 2004-12-06 12:00:00
162028 469283 31195211 31196939 1 0 -1 1 1 ENSE00000859956 1 2004-12-06 12:00:00 2004-12-06 12:00:00
162029 469283 31214121 31214286 1 0 1 1 1 ENSE00001109599 1 2004-12-06 12:00:00 2004-12-06 12:00:00
162030 469283 31210077 31210373 1 0 0 1 1 ENSE00001109600 1 2004-12-06 12:00:00 2004-12-06 12:00:00
162031 469283 31225243 31225346 1 0 2 1 1 ENSE00001109602 1 2004-12-06 12:00:00 2004-12-06 12:00:00
162032 469283 31222465 31222583 1 1 0 1 1 ENSE00001109601 1 2004-12-06 12:00:00 2004-12-06 12:00:00
162033 965899 10060 10405 1 0 0 1 1 ENSE00001109603 1 2004-12-06 12:00:00 2004-12-06 12:00:00
162034 469290 1 6 1 0 0 1 1 ENSE00000111111 1 2014-12-11 14:00:00 2014-12-11 14:00:00
162035 469290 5 9 1 0 0 1 1 ENSE00000111112 1 2014-12-11 14:00:00 2014-12-11 14:00:00
161874 21717 4
161875 21717 1
161876 21716 2
161877 21716 6
161878 21717 3
161879 21716 5
161880 21716 3
161881 21716 1
161882 21716 4
161882 21717 2
161883 21718 5
161884 21718 6
161885 21718 1
161886 21718 3
161887 21718 4
161888 21718 2
161889 21719 3
161890 21719 1
161891 21719 5
161892 21719 4
161893 21719 2
161894 21720 1
161895 21720 2
161896 21721 6
161897 21722 1
161898 21722 8
161899 21721 2
161900 21722 10
161901 21721 8
161902 21721 9
161903 21721 3
161903 21722 3
161904 21722 7
161905 21721 7
161906 21722 6
161907 21722 2
161908 21722 5
161909 21721 5
161910 21721 4
161910 21722 4
161911 21721 10
161912 21721 1
161913 21722 9
161914 21723 2
161915 21723 7
161916 21723 10
161917 21723 9
161918 21723 5
161919 21723 8
161920 21723 11
161921 21723 12
161922 21723 3
161923 21723 4
161924 21723 13
161925 21723 6
161926 21723 1
161927 21724 14
161928 21724 10
161929 21724 17
161930 21724 6
161931 21724 18
161932 21724 4
161933 21724 8
161934 21724 16
161935 21724 2
161936 21724 3
161937 21724 15
161938 21724 9
161939 21724 13
161940 21724 7
161941 21724 1
161942 21724 12
161943 21724 11
161944 21724 5
161945 21725 1
161946 21726 3
161947 21726 2
161948 21726 1
161949 21727 2
161949 21728 2
161950 21727 5
161951 21727 3
161951 21728 3
161952 21727 4
161952 21728 4
161953 21728 6
161954 21728 5
161955 21727 1
161955 21728 1
161956 21728 7
161957 21729 2
161958 21729 3
161959 21729 8
161960 21729 6
161961 21729 1
161962 21729 7
161963 21729 9
161964 21729 5
161965 21729 4
161966 21731 1
161967 21731 12
161968 21731 2
161969 21730 2
161969 21731 8
161970 21730 4
161970 21731 10
161971 21731 3
161972 21730 5
161972 21731 11
161973 21730 1
161974 21730 6
161975 21731 5
161976 21730 3
161976 21731 9
161977 21731 4
161978 21731 7
161979 21731 6
161980 21733 3
161981 21732 6
161982 21733 2
161983 21732 4
161984 21733 1
161985 21732 3
161986 21732 7
161987 21732 2
161988 21732 1
161989 21732 5
161990 21734 3
161991 21734 1
161992 21734 4
161993 21734 2
161994 21734 5
161995 21735 1
161996 21736 3
161997 21736 2
161998 21736 1
161999 21737 9
162000 21737 2
162001 21737 4
162002 21737 19
162003 21737 22
162004 21737 18