Commit be2b589f authored by Alessandro Vullo's avatar Alessandro Vullo Committed by GitHub
Browse files

Merge pull request #16 from avullo/master

CI and dependent builds enabled.
parents 8a50124f ecf950ba
blib/
.build/
_build/
cover_db/
inc/
Build
!Build/
Build.bat
.last_cover_stats
MANIFEST.bak
META.yml
MYMETA.yml
nytprof.out
pm_to_blib
.DS_Store
Thumbs.db
*.swp
*.swo
*~
\#*\#
/.emacs.desktop
/.emacs.desktop.lock
.elc
auto-save-list
tramp
.\#*
# Org-mode
.org-id-locations
*_archive
a.out
*.o
*.obj
*.class
MultiTestDB.conf
*.frozen.conf
bioperl*.zip
/modules/t/CLEAN.t
language: perl
perl:
- '5.14'
- '5.12'
- '5.10'
env:
- COVERALLS=true DB=mysql
- COVERALLS=false DB=mysql
- COVERALLS=false DB=sqlite
sudo: false
addons:
apt:
packages:
- unzip
before_install:
- git clone --branch master --depth 1 https://github.com/Ensembl/ensembl.git
- git clone -b bioperl-release-1-6-1 --depth 1 https://github.com/bioperl/bioperl-live.git
install:
- cpanm -v --installdeps --notest .
- cpanm -n Devel::Cover::Report::Coveralls
- cpanm -n DBD::SQLite
- cp travisci/MultiTestDB.conf.travisci.mysql modules/t/MultiTestDB.conf.mysql
- cp travisci/MultiTestDB.conf.travisci.SQLite modules/t/MultiTestDB.conf.SQLite
- mysql -u root -h localhost -e 'GRANT ALL PRIVILEGES ON *.* TO "travis"@"%"'
script: "./travisci/harness.sh"
# Add build stage to trigger dependent builds, run sequentially after all test jobs
# specified by the build matrix expansion have completed successfully
jobs:
include:
- stage: trigger_dependent_builds
script: ./travisci/trigger-dependent-build.sh
matrix:
exclude:
- perl: '5.10'
env: COVERALLS=false DB=mysql
- perl: '5.12'
env: COVERALLS=false DB=sqlite
- perl: '5.12'
env: COVERALLS=true DB=mysql
- perl: '5.14'
env: COVERALLS=false DB=sqlite
- perl: '5.14'
env: COVERALLS=true DB=mysql
notifications:
email:
on_success: always
on_failure: always
slack:
secure: gTcWzQsVHKPxRJ1u0U2l2+QVujmG1uFW44kAO3l46V5Im5uLTOLeM20ykk6ox4kaPHLs5ky7NGzcJmTDLaHBKjI4Sa34l4tJd0lhkv+hKj9TSv5pDDCdUX8v869Nm8LqJKh26HqvVcN7eHFRatLD/tfYvvkaP1rLLhwLLdr7czQ=
requires 'DBI';
requires 'DBD::mysql';
requires 'Test::More';
requires 'Test::Warnings';
requires 'Devel::Peek';
requires 'Devel::Cycle';
requires 'Error';
......@@ -10,3 +11,19 @@ requires 'IO::String';
requires 'IO::Scalar';
requires 'Test::FTP::Server';
requires 'MooseX::App::Simple';
requires 'File::Path';
requires 'File::Spec';
requires 'Scalar::Util';
requires 'Test::Exception';
requires 'Test::TCP';
requires 'English';
requires 'Data::Dumper';
requires 'File::Basename';
requires 'File::Copy';
requires 'File::Spec::Functions';
requires 'IO::Dir';
requires 'IO::File';
requires 'POSIX';
requires 'File::Spec';
requires 'File::Temp';
requires 'Time::Piece';
\ No newline at end of file
# This provides a default set of configurations which is merged with your
# provided MultiTestDB.conf.
#
# You should provide a MultiTestDB.conf which defines the databases
{
'databases' => {
'homo_sapiens' => {
'core' => 'Bio::EnsEMBL::DBSQL::DBAdaptor',
},
'mus_musculus' => {
'core' => 'Bio::EnsEMBL::DBSQL::DBAdaptor',
},
'multi' => {
'compara' => 'Bio::EnsEMBL::Compara::DBSQL::DBAdaptor',
},
},
}
# Copyright [1999-2015] Wellcome Trust Sanger Institute and the EMBL-European Bioinformatics Institute
# Copyright [2016-2017] EMBL-European Bioinformatics Institute
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
use strict;
use Test::More;
use Test::Warnings;
use Bio::EnsEMBL::Test::MultiTestDB;
ok(1);
# Database will be dropped when this
# object goes out of scope
my $ens_test = Bio::EnsEMBL::Test::MultiTestDB->new;
ok($ens_test);
my $dba = $ens_test->get_DBAdaptor("core");
ok($dba);
my $sth = $dba->dbc->prepare("select * from gene");
$sth->execute;
ok(scalar(@{$sth->fetchall_arrayref}) == 21, "Check gene count to prove table has data");
# now hide the gene table i.e. make an empty version of it
$ens_test->hide("core","gene");
$sth->execute;
ok(scalar(@{$sth->fetchall_arrayref}) == 0, "Check table is empty after hiding");
# restore the gene table
$ens_test->restore();
$sth->execute;
ok(scalar(@{$sth->fetchall_arrayref}) == 21, "Check table repopulated after restore");
# now save the gene table i.e. make a copy of it
$ens_test->save("core","gene");
$sth->execute;
ok(scalar(@{$sth->fetchall_arrayref}) == 21, "Check content still correct after save");
# delete 9 genes from the db
$sth = $dba->dbc->prepare("delete from gene where gene_id >= 18266");
$sth->execute;
$sth = $dba->dbc->prepare("select * from gene");
$sth->execute;
ok(scalar(@{$sth->fetchall_arrayref}) == 10,"Check results of deleting genes");
# check to see whether the restore works again
$ens_test->restore();
$sth->execute;
ok(scalar(@{$sth->fetchall_arrayref}) == 21);
$sth->finish;
done_testing();
This diff is collapsed.
1 2000-09-08 16:10:03 RepeatMask repbase 001212 RepeatMasker 1 RepeatMasker 1 RepeatMasker repeat
2 2000-09-22 10:59:05 Genscan HumanIso.smat 1 HumanIso.smat genscan 1.0 Genscan 1 genscan prediction
5 2000-09-28 17:33:27 Swall swall 1 swall wublastp 1 -hitdist=40, -cpus=1 BlastGenscanPep wublastp similarity
7 2000-10-09 15:30:14 Vertrna embl_vertrna 1 embl_vertrna wutblastn 1 -hitdist=40, -cpus=1 BlastGenscanDNA 1 wutblastn similarity
4 2000-12-18 15:12:30 tRNAscan tRNA 1 tRNAscan-SE 1.11 tRNAscan_SE 1 tRNAscan-SE tRNA
8 2000-12-18 18:28:03 CpG cpg 1 cpg 1 CPG 1 cpg cpg_island
9 2001-01-15 17:00:00 Unigene unigene.seq 1 unigene.seq wutblastn 1 -hitdist=40, -cpus=1 BlastGenscanDNA 1 wutblastn similarity
10 2001-01-15 17:00:00 QTL 1 1 QtlPlacer 1 experimental marker
12 2001-03-28 16:42:32 dbEST dbEST 1 dbEST wutblastn 1 -hitdist=40, -cpus=1 BlastGenscanDNA 1 wutblastn similarity
6 2001-09-04 17:21:19 Eponine NULL NULL NULL eponine-scan 1 /usr/opt/java131/bin/java -epojar => /usr/local/ensembl/lib/eponine-scan.jar, -threshold => 0.999 VC_EponineTSS 1 Eponine TSS
54 2002-08-12 14:52:26 human_swall_protein 1 TGE_gw 1 TargettedGeneWise TGE_gw gene
53 2002-08-12 14:52:26 human_refseq_protein 1 TGE_gw 1 TargettedGeneWise TGE_gw gene
1280 2002-08-12 14:52:26 other_swall_protein 1 similarity_genewise 1 FPC_BlastMiniGenewise similarity_genewise gene
1281 2002-08-12 14:52:26 combined-protein_cdna 1 combined_gw_e2g 1 Combine_Genewises_and_E2Gs combined_gw_e2g gene
1282 2002-08-12 14:52:26 ensembl 1 ensembl 1 Gene_Builder ensembl gene
1290 2002-08-12 14:52:26 refseq_cdna human_mRNA 1 exonerate_e2g 1 FilterESTs_and_E2G exonerate gene
1291 2002-08-12 14:52:26 embl_vertrna human_mRNA 1 exonerate_e2g 1 FilterESTs_and_E2G exonerate gene
49 \N Pfam Pfam 1 /data/blastdb/Ensembl/Pfam_ls;/data/blastdb/Ensembl/Pfam_fs /nfs/farm/Worms/bin/hmmpfam 1 /nfs/farm/Worms/bin/hmmpfam Pfam 1 PFAM domain
40 \N prints prints NULL /acari/analysis/iprscan/data/prints.pval /acari/analysis/iprscan/bin/OSF1/FingerPRINTScan NULL /acari/analysis/iprscan/bin/OSF1/FingerPRINTScan NULL Prints NULL PRINTS domain
41 \N pfscan pfscan NULL /acari/analysis/iprscan/data/prosite_prerelease.prf /acari/analysis/iprscan/bin/OSF1/pfscan NULL /acari/analysis/iprscan/bin/OSF1/pfscan NULL Profile NULL PROFILE domain
43 \N Signalp signal_peptide NULL NULL /usr/local/ensembl/bin/signalp NULL /usr/local/ensembl/bin/signalp NULL Signalp NULL Signalp annot
46 \N tmhmm transmembrane NULL NULL /acari/work1/mongin/src/pipeline4anopheles/scripts/protein_pipeline/run_tmhmm NULL /acari/work1/mongin/src/pipeline4anopheles/scripts/protein_pipeline/run_tmhmm NULL Tmhmm NULL Tmhmm annot
45 \N ncoils coiled_coil NULL NULL /usr/local/ensembl/bin/ncoils NULL /usr/local/ensembl/bin/ncoils NULL ncoils NULL ncoils annot
44 \N Seg low_complexity NULL NULL /usr/local/ensembl/bin/seg NULL /usr/local/ensembl/bin/seg NULL Seg NULL Seg annot
42 \N scanprosite prosite NULL /acari/analysis/iprscan/data/prosite.patterns /acari/analysis/iprscan/bin/scanregexpf.pl /acari/analysis/iprscan/data/confirm.pat /acari/analysis/iprscan/bin/scanregexpf.pl Prosite NULL PROSITE domain
71 \N Superfamily Superfamily 1 /data/blastdb/Ensembl/sam/superfamily /acari/work1/mongin/superfamily/superfamily.pl 1 /acari/work1/mongin/superfamily/superfamily.pl Superfamily 1 Superfamily annot
1292 \N SNPDensity \N \N \N \N \N \N \N \N \N \N \N
1293 \N RepeatCoverage \N \N \N \N \N \N \N \N \N \N \N
1500 \N miRanda \N \N \N \N \N \N \N \N \N \N \N
1501 \N cisred \N \N \N \N \N \N \N \N \N \N \N
1502 \N cisred_search \N \N \N \N \N \N \N \N \N \N \N
1503 \N DitagAlign \N \N \N \N \N \N \N \N \N \N \N
8405 2009-05-14 15:43:42 havana NULL NULL NULL NULL NULL NULL NULL NULL NULL NULL NULL
8406 2009-06-01 09:01:22 xrefexoneratedna NULL NULL NULL NULL NULL NULL NULL NULL NULL NULL NULL
8407 2007-09-07 12:01:22 est2genome_human_havana NULL 10-Nov-10 (105) NULL NULL NULL NULL ori_analysis => Est2genome_human_raw, mode => single ClusterDepthFilter NULL EST_Human similarity
8408 2007-09-07 12:01:22 uniprot_sw_havana NULL 2010_11 NULL NULL NULL NULL percentid_cutoff => 40, ori_analysis => Uniprot_raw, hit_db => Swissprot, mode => single DepthFilter NULL SwissProt NULL
1282 Genes were annotated by the Ensembl automatic analysis pipeline using either a GeneWise model from a human/vertebrate protein, a set of aligned human cDNAs followed by GenomeWise for ORF prediction or from Genscan exons supported by protein, cDNA and EST evidence. GeneWise models are further combined with available aligned cDNAs to annotate UTRs. ensembl transcript 1 web data 1 0 \N
1503 new description new label 0 0 \N
1504 updated description N 0 0 \N
8405 Manual annotation (determined on a case-by-case basis) from the <a rel="external" href="http://www.sanger.ac.uk/HGP/havana/havana.shtml">Havana</a> project. Havana 1 {'multi_name' => 'Ensembl genes, or Merged Ensembl and Havana genes','colour_key' => '[biotype]','caption' => 'Genes (Merged Ensembl/Havana) (GENCODE)','name' => 'Merged Ensembl and Havana genes (GENCODE)','label_key' => '[biotype]','default' => {'MultiTop' => 'gene_label','contigviewbottom' => 'transcript_label','MultiBottom' => 'collapsed_label','contigviewtop' => 'gene_label','cytoview' => 'gene_label','alignsliceviewbottom' => 'as_collapsed_label'},'key' => 'ensembl'}
8406 Sequences from various databases are matched to Ensembl transcripts using <a rel="external" href="http://www.biomedcentral.com/1471-2105/6/31">Exonerate</a>. These are external references, or 'Xrefs'. DNA match 0 \N
8407 Alignment of human ESTs (expressed sequence tags) to the genome using the program <a rel="external" href="http://emboss.sourceforge.net/apps/cvs/emboss/apps/est2genome.html">Est2genome</a>. ESTs are from <a rel="external" href="http://www.ncbi.nlm.nih.gov/dbEST/">dbEST</a> Human EST (EST2genome) 0 {'type' => 'est'}
8408 Proteins from the <a rel="external" href="http://uniprot.org">UniProtKB Swiss-Prot</a> database, aligned to the genome by Havana. UniProt proteins 0 \N
469271 965905 1 200 10 209 1
469271 965905 201 400 401 600 -1
469282 965905 1 100 701 800 -1
469283 317101 30263615 30426490 101 162976 1
469283 317332 30811187 30929959 101 118873 1
469283 317348 31086734 31205532 101 118899 1
469283 317523 30451401 30562994 101 111694 1
469283 318770 30726577 30811186 101 84710 1
469283 319047 30562995 30708200 101 145306 1
469283 319456 30993469 31086733 101 93365 1
469283 339816 30426491 30451400 101 25010 1
469283 345105 30708201 30726576 1 18376 1
469283 368744 30249935 30263614 101 13780 1
469283 376992 31205533 31254640 101 49208 1
469283 469270 30929960 30993468 101 63609 1
469332 317348 1 118899 1 118899 1
469333 317523 1 111694 1 111694 1
469334 317101 1 162976 1 162976 1
469335 319456 1 93365 1 93365 1
469336 345105 1 18376 1 18376 1
469337 317332 1 118873 1 118873 1
469338 368744 1 13780 1 13780 1
469339 318770 1 84710 1 84710 1
469340 339816 1 25010 1 25010 1
469341 376992 1 49208 1 49208 1
469342 319047 1 145414 1 145414 1
469343 469270 1 63609 1 63609 1
469348 317101 671650 834525 101 162976 1
469348 317332 1219222 1337994 101 118873 1
469348 317348 1494769 1613567 101 118899 1
469348 317523 859436 971029 101 111694 1
469348 318770 1134612 1219221 101 84710 1
469348 319047 971030 1116235 101 145306 1
469348 319456 1401504 1494768 101 93365 1
469348 339816 834526 859435 101 25010 1
469348 345105 1116236 1134611 1 18376 1
469348 368744 657970 671649 101 13780 1
469348 376992 1613568 1662675 101 49208 1
469348 469270 1337995 1401503 101 63609 1
965899 965888 1 16571 1 16571 1
965906 469283 100 396 31210077 31210373 1
965906 469283 397 562 31214121 31214286 1
965906 469283 563 3444 31222465 31225346 1
1 469294 10000000 10500000 PAR 469283 30300000 30800000 1
2 469351 30500000 30599999 HAP 469283 30500000 30699999 1
1 synonym Alternate names for clone Synonyms
2 FISHmap FISH information FISH map
3 organisation Organisation sequencing clone
4 state Current state of clone
5 BACend_flag BAC end flags
6 embl_acc EMBL accession number
7 superctg Super contig id.
8 seq_len Accession length
9 fp_size FP size
10 note Note
11 positioned_by Positioned by
12 bac_acc BAC end accession
13 htg_phase HTG Phase High Throughput Genome Phase
14 toplevel Top Level Top Level Non-Redundant Sequence Region
15 _rna_edit RNA editing \N
16 _selenocysteine Selenocysteine \N
17 codon_table Codon Table Alternate codon table
18 non_ref Non Reference Non Reference Sequence Region
19 karyotype_rank Rank in the karyotype For a given seq_region, if it is part of the species karyotype, will indicate its rank
20 proj_parent_g projection parent gene Stable identifier of the parent gene this gene was projected from (projection between different species and/or assemblies).
21 proj_parent_t projection parent transcript Stable identifier of the parent transcript this transcript was projected from (projection between different species and/or assemblies).
1 1 chromosome NCBI33 1 default_version
2 1 supercontig \N 2 default_version
3 1 clone \N 3 default_version
4 1 contig \N 4 default_version,sequence_level
6 1 chunk \N 5 default_version
7 1 alt_chrom \N 6 default_version
1 1 469283 1 100 50.30
2 1 469283 101 200 68.80
3 1 469283 201 300 32.00
4 1 469283 301 400 90.90
5 1 469283 401 500 88.80
6 1 469283 501 600 12.00
7 2 469283 1 100 50.30
8 2 469283 101 200 68.80
9 2 469283 201 300 32.00
10 2 469283 301 400 90.90
11 2 469283 401 500 88.80
12 2 469283 501 600 12.00
3278356 162B08-6 ZZ13 1 GAAGCAAAACACTACAATGGCGGTGCGCTCGACGCGCC
3278355 198K08-11 ZZ13 1 TTTGATAATTTATTTCAGGCTCTGCGAGAATGAACTC
3278354 137M14-9 ZZ13 1 GCCTGTTAGATTCACCCCGGTCTCGAGTCTCTCTCTC
3278353 201K11-2 ZZ13 1 CCTTGAAATTAAGAAGAAGGGCTCGCCGCCGCCGCAC
3278352 151H04-2 ZZ13 1 GTTCAGTATGGTTTTCAAGAGGGTTAATTGAAAGAG
3278351 119K09-6 ZZ13 2 TGGAATCTCCATTATTATGAGCGCGCCGCCCCACTCC
3278350 187N08-1 ZZ13 1 GGAGGTGGATGAGAGGCCAACTCCAGCTCTCTCTCT
3278349 211G12-2 ZZ13 1 GGGCTGCGATTGCAGCTCACCCTTCGTTAGATAATCA
3278348 181D04-4 ZZ13 4 TTCTTTCTTTTTTAAAGGGGGTCACGGTCGCCAAACC
3278347 213E17-4 ZZ13 1 ACATGGGAGACATTTTGCCAAGGCAGCATCAAAAAAC
3278346 112H10-9 ZZ13 2 AGAGAGAGCTGGAGTTTTGGTAAGAGCATCCTAAGC
3278345 229D11-1 ZZ13 1 GGCTGGGATAGAGGAGGACGTCTCGAGTCTCTCTCTC
3278344 235I06-3 ZZ13 1 CGAGAAAAGGAGAGGAGCCTGCTGCCTCCGCCAGAC
3278343 191F14-10 ZZ13 1 TCCAGCTGCATGAGCAAGGGCCGGGGGCGCGTCAGACC
3278342 188P19-10 ZZ13 2 ATGGTTATGAGCTGCTCTGCGAGCGCGCGAGTGAGCA
3278341 224L18-4 ZZ13 1 GTGGCTCCAGGCATCCAGCATAAAATACATGTCTCAA
3278340 156G19-5 ZZ13 3 GAGAGAGCTGGAGTTTTTACGGAAGCTGCTGCCGCCC
3278339 189F08-4 ZZ13 1 CACGGCAATTCCTAGGTCCCGAGCGGAATAACAGGCCC
3278338 134O12-6 ZZ13 1 GGAGACTGCTGGGAGTCCTAAACTCCAGCTCTCTCTCT
3278337 219H13-10 ZZ13 1 TGCAGCCGCCCATCAAGAATGGGCTCTGGAGGCAGACC
4828567 3278337 1 469273 120635196 120635214 1 1503 1 19 1 19M L
4828568 3278337 1 469273 120640125 120640142 1 1503 20 37 1 18M R
4828699 3278342 1 469288 78423526 78423543 1 1503 1 18 1 18M L
4828700 3278342 1 469288 78482803 78482821 1 1503 19 37 1 19M R
4828469 3278343 1 469271 75028243 75028261 -1 1503 1 19 1 19M L
4828470 3278343 1 469271 75026001 75026018 -1 1503 20 37 1 18M R
4828725 3278346 1 469273 98254679 98254696 1 1503 1 18 1 18M L
4828726 3278346 1 469273 97923747 97923763 1 1503 20 36 1 17M R
4828557 3278347 1 469275 100525017 100525035 -1 1503 1 19 1 19M L
4828558 3278347 1 469275 100522073 100522091 -1 1503 19 37 1 19M R
4828761 3278348 1 469288 111529629 111529647 -1 1503 1 19 1 19M L
4828762 3278348 1 469288 111528958 111528976 -1 1503 19 37 1 19M R
4828459 3278351 1 469273 83236330 83236347 -1 1503 1 18 1 18M L
4828460 3278351 1 469273 83225874 83225891 -1 1503 19 36 1 18M R
4828401 3278355 1 469275 24825423 24825440 1 1503 1 18 1 18M L
4828402 3278355 1 469275 24838796 24838814 1 1503 19 37 1 19M R
4828583 3278356 1 469272 40626355 40626373 -1 1503 1 19 1 19M L
4828584 3278356 1 469272 40572274 40572291 -1 1503 20 37 1 18M R
This diff is collapsed.
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment