From 394a5a13afa440a19ee2a033e6ddea673eaf2b75 Mon Sep 17 00:00:00 2001
From: Felix Kokocinski <fsk@sanger.ac.uk>
Date: Wed, 28 Jun 2006 08:11:04 +0000
Subject: [PATCH] test functions for the ditag modules
---
modules/t/ditag.t | 71 +++++++++++++++++
modules/t/ditagAdaptor.t | 107 ++++++++++++++++++++++++++
modules/t/ditagFeature.t | 95 +++++++++++++++++++++++
modules/t/ditagFeatureAdaptor.t | 131 ++++++++++++++++++++++++++++++++
4 files changed, 404 insertions(+)
create mode 100644 modules/t/ditag.t
create mode 100644 modules/t/ditagAdaptor.t
create mode 100644 modules/t/ditagFeature.t
create mode 100644 modules/t/ditagFeatureAdaptor.t
diff --git a/modules/t/ditag.t b/modules/t/ditag.t
new file mode 100644
index 0000000000..b598b9f9fe
--- /dev/null
+++ b/modules/t/ditag.t
@@ -0,0 +1,71 @@
+use strict;
+
+BEGIN { $| = 1;
+ use Test;
+ plan tests => 9;
+}
+
+use Bio::EnsEMBL::Test::MultiTestDB;
+use Bio::EnsEMBL::Test::TestUtils;
+
+use Bio::EnsEMBL::Map::Ditag;
+
+my $multi = Bio::EnsEMBL::Test::MultiTestDB->new();
+my $db = $multi->get_DBAdaptor( 'core' );
+
+my $ditag;
+my $dbID = 1;
+my $name = "101A01-2";
+my $type = "ZZ11";
+my $tag_count = 2;
+my $sequence = "GAGAACTTGGACCGCAGAGAATACACACAAATCAAACC";
+my $adaptor = $db->get_DitagAdaptor;
+my $ditag_id = 3278337;
+
+######
+# 1 #
+######
+
+#test new
+
+$ditag = Bio::EnsEMBL::Map::Ditag->new (
+ -dbID => $dbID,
+ -name => $name,
+ -type => $type,
+ -tag_count => $tag_count,
+ -sequence => $sequence,
+ -adaptor => $adaptor,
+ );
+ok($ditag && $ditag->isa('Bio::EnsEMBL::Map::Ditag'));
+
+#######
+# 2-6 #
+#######
+
+#test dbID, name, type, sequence, tag-count
+
+ok($ditag->dbID eq $dbID);
+ok($ditag->name eq $name);
+ok($ditag->type eq $type);
+ok($ditag->sequence() eq $sequence);
+ok($ditag->tag_count > 0);
+
+######
+# 7 #
+######
+
+#test adaptor
+
+ok($ditag->adaptor->isa('Bio::EnsEMBL::Map::DBSQL::DitagAdaptor'));
+
+#######
+# 8-9 #
+#######
+
+#test get_ditagFeatures
+
+my $ditagFeatures = $adaptor->fetch_by_dbID($ditag_id)->get_ditagFeatures();
+ok(scalar @$ditagFeatures);
+ok($ditagFeatures->[0]->isa('Bio::EnsEMBL::Map::DitagFeature'));
+
+1;
diff --git a/modules/t/ditagAdaptor.t b/modules/t/ditagAdaptor.t
new file mode 100644
index 0000000000..985c0c14cd
--- /dev/null
+++ b/modules/t/ditagAdaptor.t
@@ -0,0 +1,107 @@
+use strict;
+
+BEGIN { $| = 1;
+ use Test ;
+ plan tests => 11;
+}
+
+use Bio::EnsEMBL::Test::MultiTestDB;
+use Bio::EnsEMBL::Test::TestUtils;
+
+use Bio::EnsEMBL::Map::DBSQL::DitagAdaptor;
+
+my $multi = Bio::EnsEMBL::Test::MultiTestDB->new();
+my $db = $multi->get_DBAdaptor( 'core' );
+
+my $name = "101A01-2";
+my $type = "ZZ13";
+my $tag_count = 2;
+my $sequence = "GAGAACTTGGACCGCAGAGAATACACACAAATCAAACC";
+
+######
+# 1 #
+######
+
+#test get_DitagAdaptor
+my $ditag_adaptor = $db->get_DitagAdaptor;
+ok($ditag_adaptor && ref $ditag_adaptor);
+
+#####
+# 2 #
+#####
+
+#test store
+my $new_ditag = Bio::EnsEMBL::Map::Ditag->new (
+ -name => $name,
+ -type => $type,
+ -count => $tag_count,
+ -sequence => $sequence,
+ -adaptor => $db,
+ );
+my @ditags = ( $new_ditag );
+
+#hide the contents of ditag table
+$multi->hide('core', 'ditag');
+
+ok($ditag_adaptor->store(\@ditags));
+
+#######
+# 3-4 #
+#######
+
+#test fetch_all_by_name
+
+my $ditags = $ditag_adaptor->fetch_by_name($name);
+#if feature was stored it has a dbID now
+ok(scalar(@$ditags) && $ditags->[0]->isa('Bio::EnsEMBL::Map::Ditag'));
+ok($ditags->[0]->name eq $name);
+
+#######
+# 5-6 #
+#######
+
+#test fetch_all_by_type
+
+$ditags = $ditag_adaptor->fetch_all_by_type($type);
+ok(scalar(@$ditags) && $ditags->[0]->isa('Bio::EnsEMBL::Map::Ditag'));
+ok($ditags->[0]->type eq $type);
+
+#######
+# 7-8 #
+#######
+
+#test fetch_all_by_name_and_type
+
+$ditags = $ditag_adaptor->fetch_all_by_name_and_type($name, $type);
+ok(scalar(@$ditags) && $ditags->[0]->isa('Bio::EnsEMBL::Map::Ditag'));
+ok($ditags->[0]->type eq $type && $ditags->[0]->name eq $name);
+
+######
+# 9 #
+######
+
+#test fetch_all
+$ditags = $ditag_adaptor->fetch_all();
+ok(scalar(@$ditags) && $ditags->[0]->isa('Bio::EnsEMBL::Map::Ditag'));
+
+#unhide table after having stored
+$multi->restore('core', 'ditag');
+
+######
+# 10 #
+######
+
+#test fetch_with_limit
+$ditags = $ditag_adaptor->fetch_with_limit($type, 5, 0);
+ok((scalar(@$ditags) == 5) && $ditags->[0]->isa('Bio::EnsEMBL::Map::Ditag'));
+
+######
+# 11 #
+######
+
+#test list_dbIDs
+
+my $dbIDs = $ditag_adaptor->list_dbIDs();
+ok(scalar @$dbIDs);
+
+1;
diff --git a/modules/t/ditagFeature.t b/modules/t/ditagFeature.t
new file mode 100644
index 0000000000..5c804d6680
--- /dev/null
+++ b/modules/t/ditagFeature.t
@@ -0,0 +1,95 @@
+use strict;
+
+BEGIN { $| = 1;
+ use Test;
+ plan tests => 17;
+}
+
+use Bio::EnsEMBL::Test::MultiTestDB;
+use Bio::EnsEMBL::Test::TestUtils;
+
+use Bio::EnsEMBL::Map::DitagFeature;
+use Bio::EnsEMBL::Analysis;
+
+my $multi = Bio::EnsEMBL::Test::MultiTestDB->new();
+my $db = $multi->get_DBAdaptor( 'core' );
+
+my $dfa = $db->get_DitagFeatureAdaptor;
+
+my $slice = $db->get_SliceAdaptor->fetch_by_region('chromosome','20');
+my $analysis = $db->get_AnalysisAdaptor->fetch_by_logic_name('DitagAlign' );
+
+my $dbID = 4828567;
+my $ditag_id = 3278337;
+my $qstart = 120635196;
+my $qend = 120635214;
+my $qstrand = 1;
+my $tstart = 1;
+my $tend = 19;
+my $tstrand = 1;
+my $ditag_side = 'L';
+my $ditag_pair_id = 1;
+my $cigar_line = '19M';
+
+
+######
+# 1 #
+######
+
+#test new
+
+my $feature = Bio::EnsEMBL::Map::DitagFeature->new(
+ -slice => $slice,
+ -start => $qstart,
+ -end => $qend,
+ -strand => $qstrand,
+ -hit_start => $tstart,
+ -hit_end => $tend,
+ -hit_strand => $tstrand,
+ -ditag_id => $ditag_id,
+ -ditag_side => $ditag_side,
+ -ditag_pair_id => $ditag_pair_id,
+ -cigar_line => $cigar_line,
+ -analysis => $analysis,
+ );
+ok($feature && $feature->isa('Bio::EnsEMBL::Map::DitagFeature'));
+
+########
+# 2-14 #
+########
+
+#test ditag_id, ditag_side, hit_start, hit_end,
+# hit_strand, cigar_line, start, end, strand,
+# dbID, sequence, slice, ditag_pair_id
+
+my $ditagFeatures = $dfa->fetch_by_ditagID($ditag_id);
+my $ditagFeature = $ditagFeatures->[0];
+
+ok(defined $ditagFeature && $ditagFeature->isa('Bio::EnsEMBL::Map::DitagFeature'));
+
+ok($ditagFeature->ditag_id == $ditag_id);
+ok($ditagFeature->slice->isa('Bio::EnsEMBL::Slice'));
+ok($ditagFeature->ditag_pair_id == $ditag_pair_id);
+ok($ditagFeature->ditag_side eq $ditag_side);
+ok($ditagFeature->hit_start == $tstart);
+ok($ditagFeature->hit_end == $tend);
+ok($ditagFeature->hit_strand eq $tstrand);
+ok($ditagFeature->cigar_line eq $cigar_line);
+ok($ditagFeature->start == $qstart);
+ok($ditagFeature->end == $qend);
+ok($ditagFeature->strand eq $qstrand);
+ok($ditagFeature->dbID == $dbID);
+ok(length($ditagFeature->sequence) > 10);
+
+######
+# 13 #
+######
+
+#test fetch_ditag
+
+my $ditag = $ditagFeature->fetch_ditag();
+
+ok(defined $ditag && $ditag->isa('Bio::EnsEMBL::Map::Ditag'));
+ok($ditag->dbID == $ditag_id);
+
+1;
diff --git a/modules/t/ditagFeatureAdaptor.t b/modules/t/ditagFeatureAdaptor.t
new file mode 100644
index 0000000000..deec70c8fd
--- /dev/null
+++ b/modules/t/ditagFeatureAdaptor.t
@@ -0,0 +1,131 @@
+use strict;
+
+BEGIN { $| = 1;
+ use Test ;
+ plan tests => 12;
+}
+
+use Bio::EnsEMBL::Test::MultiTestDB;
+use Bio::EnsEMBL::Test::TestUtils;
+
+use Bio::EnsEMBL::Map::Ditag;
+use Bio::EnsEMBL::Analysis;
+
+my $multi = Bio::EnsEMBL::Test::MultiTestDB->new();
+my $db = $multi->get_DBAdaptor( 'core' );
+
+my $region = 11;
+my $ditag_id = 1;
+my $qstart = 120635196;
+my $qend = 120635214;
+my $qstrand = 1;
+my $tstart = 3;
+my $tend = 19;
+my $tstrand = 1;
+my $ditag_side = 'L';
+my $ditag_pair_id = 1;
+my $cigar_line = '17M',
+my $type = "ZZ13";
+
+my $dbID = 4828567;
+my $other_ditag = 3278337;
+#469273
+
+my $slice = $db->get_SliceAdaptor->fetch_by_region('chromosome', $region);
+my $analysis = $db->get_AnalysisAdaptor->fetch_by_logic_name('DitagAlign' );
+
+######
+# 1 #
+######
+
+#test constructor
+
+my $dfa = $db->get_DitagFeatureAdaptor;
+ok($dfa && ref $dfa);
+
+######
+# 2 #
+######
+
+#test construction
+
+my $feature = Bio::EnsEMBL::Map::DitagFeature->new(
+ -slice => $slice,
+ -start => $qstart,
+ -end => $qend,
+ -strand => $qstrand,
+ -hit_start => $tstart,
+ -hit_end => $tend,
+ -hit_strand => $tstrand,
+ -ditag_id => $ditag_id,
+ -ditag_side => $ditag_side,
+ -ditag_pair_id => $ditag_pair_id,
+ -cigar_line => $cigar_line,
+ -analysis => $analysis,
+ );
+ok($feature && $feature->isa('Bio::EnsEMBL::Map::DitagFeature'));
+
+
+#######
+# 3-4 #
+#######
+
+#test store
+
+#hide the contents of ditag_feature table
+$multi->hide('core', 'ditag_feature');
+
+$dfa->store($feature);
+ok($feature->dbID && $feature->adaptor == $dfa);
+
+my $testfeature = $dfa->fetch_by_dbID($feature->dbID);
+ok($testfeature && $testfeature->isa('Bio::EnsEMBL::Map::DitagFeature'));
+
+#unhide table
+$multi->restore('core', 'ditag_feature');
+
+########
+# 5-11 #
+########
+
+#test fetch methods
+
+#test fetch all
+my $dfs = $dfa->fetch_all();
+ok(scalar @$dfs && $dfs->[0]->isa('Bio::EnsEMBL::Map::DitagFeature'));
+
+#test fetch by dbID
+my $df = $dfa->fetch_by_dbID($dbID);
+ok($df && $df->isa('Bio::EnsEMBL::Map::DitagFeature') && $df->dbID == $dbID);
+
+#test fetch by ditagID
+$dfs = $dfa->fetch_by_ditagID($other_ditag);
+ok((scalar @$dfs == 2) && $dfs->[0]->isa('Bio::EnsEMBL::Map::DitagFeature')
+ && $dfs->[0]->ditag_id == $other_ditag);
+
+#test fetch by type
+$dfs = $dfa->fetch_all_by_type($type);
+ok((scalar @$dfs) && $dfs->[0]->isa('Bio::EnsEMBL::Map::DitagFeature')
+ && $dfs->[0]->fetch_ditag->type eq $type);
+
+# test fetch all by slice
+$slice = $db->get_SliceAdaptor->fetch_by_region('chromosome', $region,
+ $qstart, $qend);
+$dfs = $dfa->fetch_all_by_Slice($slice);
+ok(scalar(@$dfs) && $dfs->[0]->isa('Bio::EnsEMBL::Map::DitagFeature'));
+
+#test fetch_grouped
+$dfs = $dfa->fetch_grouped('', $type);
+ok(scalar @$dfs);
+ok($dfs->[0]->{'ditag_id'} && $dfs->[0]->{'start'} && $dfs->[0]->{'end'});
+
+######
+# 12 #
+######
+
+#test list_dbIDs
+
+my $dbIDs = $dfa->list_dbIDs();
+ok(scalar @$dbIDs);
+
+1;
--
GitLab