diff --git a/modules/Bio/EnsEMBL/Analysis/Genscan.pm b/modules/Bio/EnsEMBL/Analysis/Genscan.pm
index d61efb1441739273cbdbac2fdb4370a5c75bd38f..3f494228b2f720e4b4b00b3f811b0db529c4e1ba 100755
--- a/modules/Bio/EnsEMBL/Analysis/Genscan.pm
+++ b/modules/Bio/EnsEMBL/Analysis/Genscan.pm
@@ -334,7 +334,7 @@ EXON: foreach my $exon ($tran->each_Exon) {
$trans[2] = $exseq->translate('*','X',1);
my $i = 0;
- $phase;
+ $phase = 4;
# Loop over all frames 0,1,2
for ($i=0; $i < 3; $i++) {
diff --git a/modules/Bio/EnsEMBL/DBSQL/Contig.pm b/modules/Bio/EnsEMBL/DBSQL/Contig.pm
index a078ddb9d0f2a3ff82d076b522940749504ddf60..ec51f4f9b4470aa60bbb7ddb07500c086bc422df 100755
--- a/modules/Bio/EnsEMBL/DBSQL/Contig.pm
+++ b/modules/Bio/EnsEMBL/DBSQL/Contig.pm
@@ -249,6 +249,9 @@ sub get_all_SimilarityFeatures{
$analysis = $analhash{$analysisid};
}
+ if( !defined $name ) {
+ $name = 'no_source';
+ }
if( $hid ne '__NONE__' ) {
# is a paired feature
diff --git a/modules/Bio/EnsEMBL/DBSQL/Obj.pm b/modules/Bio/EnsEMBL/DBSQL/Obj.pm
index b8dea01cf08251dc0e6260cbf391e53235df9f50..aeee17a013e23d94f931f4fbe672b5a8b7e82656 100755
--- a/modules/Bio/EnsEMBL/DBSQL/Obj.pm
+++ b/modules/Bio/EnsEMBL/DBSQL/Obj.pm
@@ -1091,9 +1091,7 @@ sub delete_Gene{
sub geneid_to_cloneid{
my ($self,$geneid) = @_;
- my $sth = $self->prepare("select count(*),cl.id, cont.clone ,ex.contig, tran.gene from clone as cl,contig as cont, transcript as tran, exon_transcript as et, exon as ex where ex.id = et.exon and tran.id = et.transcript and ex.contig = cont.id and cont.clone = cl.id and tran.gene = '$geneid' group by cl.id");
-
-# my $sth = $self->prepare("select p1.id from contig as p1, transcript as p2, exon_transcript as p3 where p2.gene = '$geneid' and p2.id = p3.transcript and p3 ");
+ my $sth = $self->prepare("select p1.id from contig as p1, transcript as p2, exon_transcript as p3 where p2.gene = '$geneid' and p2.id = p3.transcript and p3 ");
my @out;
diff --git a/modules/Bio/EnsEMBL/Exon.pm b/modules/Bio/EnsEMBL/Exon.pm
index 14303e93e034b86c39a1d1aa901c5854ea48ae7d..ac00d8cdaf2b6397deb611f711cbb0b7c91241d0 100755
--- a/modules/Bio/EnsEMBL/Exon.pm
+++ b/modules/Bio/EnsEMBL/Exon.pm
@@ -84,6 +84,7 @@ use strict;
# Object preamble - inherits from Bio::SeqFeature::Generic
use Bio::SeqFeature::Generic;
+use Bio::Seq; # exons have to have sequences...
@ISA = qw(Bio::SeqFeature::Generic Exporter);
# new() is inherited from Bio::Root::Object
diff --git a/modules/Bio/EnsEMBL/PerlDB/Clone.pm b/modules/Bio/EnsEMBL/PerlDB/Clone.pm
index f7c28f5b3b8376b9d92161656407d4b72a0e72a2..377fe9019a54a373c7aa2aa9492bb61fa6592e2a 100755
--- a/modules/Bio/EnsEMBL/PerlDB/Clone.pm
+++ b/modules/Bio/EnsEMBL/PerlDB/Clone.pm
@@ -175,6 +175,110 @@ sub id{
}
+=head2 embl_id
+
+ Title : embl_id
+ Usage : $obj->embl_id($newval)
+ Function:
+ Returns : value of embl_id
+ Args : newvalue (optional)
+
+
+=cut
+
+sub embl_id{
+ my $obj = shift;
+ if( @_ ) {
+ my $value = shift;
+ $obj->{'embl_id'} = $value;
+ }
+ return $obj->{'embl_id'};
+
+}
+
+=head2 embl_version
+
+ Title : embl_version
+ Usage : $obj->embl_version($newval)
+ Function:
+ Returns : value of embl_version
+ Args : newvalue (optional)
+
+
+=cut
+
+sub embl_version{
+ my $obj = shift;
+ if( @_ ) {
+ my $value = shift;
+ $obj->{'embl_version'} = $value;
+ }
+ return $obj->{'embl_version'};
+
+}
+
+=head2 seq_date
+
+ Title : seq_date
+ Usage : $obj->seq_date($newval)
+ Function:
+ Returns : value of seq_date
+ Args : newvalue (optional)
+
+
+=cut
+
+sub seq_date{
+ my $obj = shift;
+ if( @_ ) {
+ my $value = shift;
+ $obj->{'seq_date'} = $value;
+ }
+ return $obj->{'seq_date'};
+
+}
+
+=head2 version
+
+ Title : version
+ Usage : $obj->version($newval)
+ Function:
+ Returns : value of version
+ Args : newvalue (optional)
+
+
+=cut
+
+sub version{
+ my $obj = shift;
+ if( @_ ) {
+ my $value = shift;
+ $obj->{'version'} = $value;
+ }
+ return $obj->{'version'};
+
+}
+=head2 htg_phase
+
+ Title : htg_phase
+ Usage : $obj->htg_phase($newval)
+ Function:
+ Returns : value of htg_phase
+ Args : newvalue (optional)
+
+
+=cut
+
+sub htg_phase{
+ my $obj = shift;
+ if( @_ ) {
+ my $value = shift;
+ $obj->{'htg_phase'} = $value;
+ }
+ return $obj->{'htg_phase'};
+
+}
+
1;
diff --git a/modules/Bio/EnsEMBL/PerlDB/Contig.pm b/modules/Bio/EnsEMBL/PerlDB/Contig.pm
index 040becf09b94f30a4ab07dc6175268b8efca93d0..35b553d6b38bcef4ac2c57d90d956d67a4abda92 100755
--- a/modules/Bio/EnsEMBL/PerlDB/Contig.pm
+++ b/modules/Bio/EnsEMBL/PerlDB/Contig.pm
@@ -62,7 +62,8 @@ sub _initialize {
my $make = $self->SUPER::_initialize;
- $self->{'_sf_array'} = [];
+ $self->{'_repeat_array'} = [];
+ $self->{'_simil_array'} = [];
$self->{'_gene_array'} = [];
# set stuff in self from @args
@@ -70,9 +71,9 @@ sub _initialize {
}
-=head2 get_all_SeqFeatures
+=head2 get_all_Genes
- Title : get_all_SeqFeatures
+ Title : get_all_Genes
Usage :
Function:
Example :
@@ -82,15 +83,16 @@ sub _initialize {
=cut
-sub get_all_SeqFeatures{
+sub get_all_Genes{
my ($self) = @_;
-
- return @{$self->{'_sf_array'}};
+
+ return @{$self->{'_gene_array'}};
}
-=head2 get_all_Genes
- Title : get_all_Genes
+=head2 add_Gene
+
+ Title : add_Gene
Usage :
Function:
Example :
@@ -100,15 +102,19 @@ sub get_all_SeqFeatures{
=cut
-sub get_all_Genes{
- my ($self) = @_;
-
- return @{$self->{'_gene_array'}};
+sub add_Gene{
+ my ($self,$gene) = @_;
+
+ if( !$gene->isa("Bio::EnsEMBL::Gene") ) {
+ $self->throw("$gene is a not a Bio::EnsEMBL::Gene type");
+ }
+
+ push(@{$self->{'_gene_array'}},$gene);
}
-=head2 add_SeqFeature
+=head2 get_all_RepeatFeatures
- Title : add_SeqFeature
+ Title : get_all_RepeatFeatures
Usage :
Function:
Example :
@@ -118,19 +124,38 @@ sub get_all_Genes{
=cut
-sub add_SeqFeature{
- my ($self,$sf) = @_;
+sub get_all_RepeatFeatures{
+ my ($self,@args) = @_;
+
+ return @{$self->{'_repeat_array'}};
+}
+
+=head2 add_RepeatFeature
+
+ Title : add_RepeatFeature
+ Usage :
+ Function:
+ Example :
+ Returns :
+ Args :
- if( $sf->isa("Bio::SeqFeatureI") ) {
- $self->throw("$sf is a not a SeqFeatureI type");
+
+=cut
+
+sub add_RepeatFeature{
+ my ($self,$value) = @_;
+
+ if( !ref $value || !$value->isa('Bio::EnsEMBL::Repeat') ) {
+ $self->throw("$value is not a repeat");
}
- push(@{$self->{'_sf_array'}},$sf);
+ push(@{$self->{'_repeat_array'}},$value);
}
-=head2 add_Gene
- Title : add_Gene
+=head2 get_all_SimilarityFeatures
+
+ Title : get_all_SimilarityFeatures
Usage :
Function:
Example :
@@ -140,16 +165,35 @@ sub add_SeqFeature{
=cut
-sub add_Gene{
- my ($self,$gene) = @_;
+sub get_all_SimilarityFeatures{
+ my ($self,@args) = @_;
- if( !$gene->isa("Bio::EnsEMBL::Gene") ) {
- $self->throw("$gene is a not a Bio::EnsEMBL::Gene type");
+ return @{$self->{'_simil_array'}};
+}
+
+=head2 add_SimilarityFeatures
+
+ Title : add_SimilarityFeatures
+ Usage :
+ Function:
+ Example :
+ Returns :
+ Args :
+
+
+=cut
+
+sub add_SimilarityFeatures {
+ my ($self,$value) = @_;
+
+ if( !ref $value || !$value->isa('Bio::EnsEMBL::FeaturePair') ) {
+ $self->throw("$value is not a FeaturePair");
}
- push(@{$self->{'_gene_array'}},$gene);
+ push(@{$self->{'_simil_array'}},$value);
}
+
=head2 offset
Title : offset
@@ -192,6 +236,27 @@ sub orientation{
}
+=head2 order
+
+ Title : order
+ Usage : $obj->order($newval)
+ Function:
+ Returns : value of order
+ Args : newvalue (optional)
+
+
+=cut
+
+sub order{
+ my $obj = shift;
+ if( @_ ) {
+ my $value = shift;
+ $obj->{'order'} = $value;
+ }
+ return $obj->{'order'};
+
+}
+
=head2 seq
@@ -240,4 +305,25 @@ sub id{
}
+=head2 version
+
+ Title : version
+ Usage : $obj->version($newval)
+ Function:
+ Returns : value of version
+ Args : newvalue (optional)
+
+
+=cut
+
+sub version{
+ my $obj = shift;
+ if( @_ ) {
+ my $value = shift;
+ $obj->{'version'} = $value;
+ }
+ return $obj->{'version'};
+
+}
+
1;
diff --git a/modules/Bio/EnsEMBL/Repeat.pm b/modules/Bio/EnsEMBL/Repeat.pm
index 67f73f3a399bad056e48462fb55f7f816d6a1505..17855c79187be1c43a4a952fa0d8b5bf0bf794cc 100755
--- a/modules/Bio/EnsEMBL/Repeat.pm
+++ b/modules/Bio/EnsEMBL/Repeat.pm
@@ -11,25 +11,11 @@
=head1 NAME
-Bio::EnsEMBL::Repeat
+Bio::EnsEMBL::Repeat - Object for repeats
=head1 SYNOPSIS
-
-=head1 DESCRIPTION
-
-Extends Bio::EnsEMBL::FeaturePair to store
-genomic repeat features.
-
-Creation:
-
- my $rep = new Bio::EnsEMBL::Repeat(-start => $start,
- -end => $end,
- -strand => $strand,
- -source => $source,
- -primary=> $primary,
- );
-
-Manipulation:
+
+ # behaves exactly like a Bio::EnsEMBL::FeaturePair
my $start = $rep->start;
my $end = $rep->end;
@@ -38,6 +24,14 @@ Manipulation:
my $repstart = $rep->hstart;
my $repend = $rep->hend;
+=head1 DESCRIPTION
+
+Extends Bio::EnsEMBL::FeaturePair to store
+genomic repeat features. Only here really so we can
+put in to_FTHelper (EMBL/GenBank dumping code)
+specific to repeats.
+
+
=head1 CONTACT
diff --git a/modules/Bio/EnsEMBL/SeqFeature.pm b/modules/Bio/EnsEMBL/SeqFeature.pm
index afdbdfb1cbb20f1828908ca1713dbe97e2f6036c..66e2e016154ed84b91bf1599ce0cbf71e82e0a62 100755
--- a/modules/Bio/EnsEMBL/SeqFeature.pm
+++ b/modules/Bio/EnsEMBL/SeqFeature.pm
@@ -392,17 +392,17 @@ sub validate {
sub vthrow {
my ($self,$message) = @_;
- print("Error validating feature [$message]\n");
- print(" Seqname : [" . $self->{_gsf_seqname} . "]\n");
- print(" Start : [" . $self->{_gsf_start} . "]\n");
- print(" End : [" . $self->{_gsf_end} . "]\n");
- print(" Strand : [" . $self->{_gsf_strand} . "]\n");
- print(" Score : [" . $self->{_gsf_score} . "]\n");
- print(" Source_tag : [" . $self->{_source_tag} . "]\n");
- print(" Primary_tag : [" . $self->{_primary_tag} . "]\n");
- print(" Analysis : [" . $self->{_analysis} . "]\n");
-
- $self->throw("");
+ print(STDERR "Error validating feature [$message]\n");
+ print(STDERR " Seqname : [" . $self->{_gsf_seqname} . "]\n");
+ print(STDERR " Start : [" . $self->{_gsf_start} . "]\n");
+ print(STDERR " End : [" . $self->{_gsf_end} . "]\n");
+ print(STDERR " Strand : [" . $self->{_gsf_strand} . "]\n");
+ print(STDERR " Score : [" . $self->{_gsf_score} . "]\n");
+ print(STDERR " Source_tag : [" . $self->{_source_tag} . "]\n");
+ print(STDERR " Primary_tag : [" . $self->{_primary_tag} . "]\n");
+ print(STDERR " Analysis : [" . $self->{_analysis} . "]\n");
+
+ $self->throw("Invalid feature - see dump on STDERR");
}
# These methods are specified in the SeqFeatureI interface but we don't want
# people to store data in them. These are just here in order to keep
diff --git a/modules/t/DB.t b/modules/t/DB.t
index 2718a5462fb7c1f423d8dfd64c15955562088204..45ace1ea930cb39cae62ab60cc5c19e2b8318deb 100755
--- a/modules/t/DB.t
+++ b/modules/t/DB.t
@@ -21,7 +21,7 @@
## We start with some black magic to print on failure.
-BEGIN { $| = 1; print "1..5\n";
+BEGIN { $| = 1; print "1..7\n";
use vars qw($loaded); }
END {print "not ok 1\n" unless $loaded;}
@@ -67,18 +67,33 @@ if( $@ ) {
print "ok 2\n";
@cloneids = $db->get_all_Clone_id();
my $clone = $db->get_Clone($cloneids[0]);
+
+# check clone stuff.
+$discard = $clone->htg_phase();
+$discard = $clone->embl_id();
+$discard = $clone->version();
+$discard = $clone->embl_version();
print "ok 3\n";
+
my @contigs = $clone->get_all_Contigs();
my $contig = $db->get_Contig($contigs[0]->id);
print "ok 4\n";
+@repeats = $contig->get_all_RepeatFeatures();
+@repeats = ();
+print "ok 5\n";
+
+@simil = $contig->get_all_SimilarityFeatures();
+@simil = ();
+print "ok 6\n";
+
foreach $gene ( $clone->get_all_Genes() ) {
if( ! $gene->isa("Bio::EnsEMBL::Gene") ) {
- print "not ok 5\n";
+ print "not ok 7\n";
exit(1);
}
}
-print "ok 5\n";
+print "ok 7\n";
diff --git a/modules/t/EmblDump.t b/modules/t/EmblDump.t
index c6b281640c0435e8bfd0e72fc4abeb8ff69e7985..fd9ae3442eb8287cafcb4373535c382c0cccd056 100755
--- a/modules/t/EmblDump.t
+++ b/modules/t/EmblDump.t
@@ -50,13 +50,15 @@ $seq = Bio::Seq->new( -id => 'Contig-1' , -seq => 'ATGGCGGATGTTTATGTGGGTGGCCCGGG
#$contig->add_SeqFeature($sf);
$contig->offset(1);
$contig->orientation(1);
+$contig->order(1);
$contig->seq($seq);
$contig->id('Contig-1');
$seq2 = Bio::Seq->new( -id => 'Contig-2' , -seq => 'TCAGAAATTTGGGTGTTTTGGCCCTGGTGGTTTGGGTTT' );
$contig2 = Bio::EnsEMBL::PerlDB::Contig->new();
-$contig2->offset(60);
+$contig2->offset(900);
$contig2->orientation(1);
+$contig2->order(2);
$contig2->id('Contig-2');
$contig2->seq($seq2);
@@ -71,11 +73,11 @@ $ex1->start(8);
$ex1->end(13);
$ex1->phase(0);
$ex1->strand(1);
-$ex1->attach_seq($seq2);
-$ex1->contig_id('Contig-2');
+$ex1->attach_seq($seq);
+$ex1->contig_id('Contig-1');
$ex1->clone_id('test-clone');
-$ex1->created('dummy_creation_date');
-$ex1->modified('dummy_modification_date');
+$ex1->created(time());
+$ex1->modified(time());
$ex1->id('exon-id-1');
$ex2->start(18);
@@ -85,8 +87,8 @@ $ex2->strand(1);
$ex2->attach_seq($seq2);
$ex2->contig_id('Contig-2');
$ex2->clone_id('test-clone');
-$ex2->created('dummy_creation_date');
-$ex2->modified('dummy_modification_date');
+$ex2->created(time());
+$ex2->modified(time());
$ex2->id('exon-id-2');
$gene->id('gene-id');
@@ -95,6 +97,13 @@ $tr->id('transcript-id');
$tr->add_Exon($ex1);
$tr->add_Exon($ex2);
+$trans = Bio::EnsEMBL::Translation->new();
+$trans->start_exon_id('exon-id-1');
+$trans->end_exon_id('exon-id-2');
+$trans->start(8);
+$trans->end(23);
+$tr->translation($trans);
+$tr->id('peptide-id');
$gene->add_Transcript($tr);
$contig->add_Gene($gene);
@@ -113,7 +122,7 @@ $clone->add_Contig($contig2);
print "ok 2\n";
$as = $clone->get_AnnSeq();
-$asio = Bio::AnnSeqIO->new(-format => 'EMBL' , -fh => \*STDERR ) ;
+$asio = Bio::AnnSeqIO->new( '-format' => 'EMBL' , -fh => \*STDERR ) ;
$asio->_post_sort(\&sort_FTHelper_EnsEMBL);
$asio->write_annseq($as);
diff --git a/modules/t/Gene.t b/modules/t/Gene.t
index 379762e834902372c061c9e8a372b29c6a42689f..ea0ddf85cb6212ca375b15193fd1048b826726b2 100755
--- a/modules/t/Gene.t
+++ b/modules/t/Gene.t
@@ -21,7 +21,7 @@
## We start with some black magic to print on failure.
-BEGIN { $| = 1; print "1..8\n";
+BEGIN { $| = 1; print "1..9\n";
use vars qw($loaded); }
END {print "not ok 1\n" unless $loaded;}
@@ -29,6 +29,7 @@ END {print "not ok 1\n" unless $loaded;}
use Bio::EnsEMBL::Gene;
use Bio::EnsEMBL::Transcript;
use Bio::EnsEMBL::Exon;
+use Bio::EnsEMBL::Translation;
$loaded = 1;
print "ok 1\n"; # 1st test passes.
@@ -43,33 +44,54 @@ $ex2 = new Bio::EnsEMBL::Exon;
$ex3 = new Bio::EnsEMBL::Exon;
print "ok 4\n";
+$seq = Bio::Seq->new( -id => 'Contig-1' , -seq => 'ATGGCGGATGTTTATGTGGGTGGCCCGGGG' );
+$seq2 = Bio::Seq->new( -id => 'Contig-2' , -seq => 'TCAGAAATTTGGGTGTTTTGGCCCTGGTGGTTTGGGTTT' );
+
$ex1->id("dummy_id_1");
$ex1->contig_id("c_id_1");
-$ex1->start(10);
-$ex1->end(20);
+$ex1->phase(0);
+$ex1->start(8);
+$ex1->end(13);
+$ex1->attach_seq($seq);
$ex1->strand(1);
$ex2->id("dummy_id_2");
-$ex2->contig_id("c_id_1");
-$ex2->start(40);
-$ex2->end(50);
+$ex2->contig_id("c_id_2");
+$ex2->phase(0);
+$ex2->start(18);
+$ex2->end(23);
+$ex2->attach_seq($seq2);
$ex2->strand(1);
$ex3->id("dummy_id_3");
$ex3->contig_id("c_id_2");
-$ex3->start(40);
-$ex3->end(50);
+$ex3->phase(0);
+$ex3->start(26);
+$ex3->end(28);
+$ex3->attach_seq($seq2);
$ex3->strand(1);
$tr->add_Exon($ex1);
$tr->add_Exon($ex2);
-
-$tr->add_Exon($ex1);
-$tr->add_Exon($ex2);
-$tr->add_Exon($ex3);
+$trans = Bio::EnsEMBL::Translation->new();
+$trans->start_exon_id('dummy_id_1');
+$trans->start(8);
+$trans->end_exon_id('dummy_id_2');
+$trans->end(23);
+$tr->translation($trans);
+
+$tr1->add_Exon($ex1);
+$tr1->add_Exon($ex2);
+$tr1->add_Exon($ex3);
+$trans = Bio::EnsEMBL::Translation->new();
+$trans->start_exon_id('dummy_id_1');
+$trans->start(8);
+$trans->end_exon_id('dummy_id_3');
+$trans->end(28);
+$tr1->translation($trans);
$gene->add_Transcript($tr);
$gene->add_Transcript($tr1);
@@ -110,6 +132,11 @@ if( scalar @contigs != 2 ) {
print "ok 8\n";
}
+foreach $trans ( $gene->each_Transcript ) {
+ $pep = $trans->translate();
+ }
+print "ok 9\n";
+$pep = 0;
diff --git a/modules/t/Ghost.t b/modules/t/Ghost.t
index 6fc0fb33da4899426fcede0c7083874e97efcde4..bad18212c27133bdadf6bb7a0b691a78faa15a75 100755
--- a/modules/t/Ghost.t
+++ b/modules/t/Ghost.t
@@ -27,6 +27,7 @@ BEGIN { $| = 1; print "1..2\n";
END {print "not ok 1\n" unless $loaded;}
use Bio::EnsEMBL::Ghost;
+$loaded = 1;
print "ok 1\n"; # 1st test passes.
$ghost = new Bio::EnsEMBL::Ghost;