Commit 5bd0fbd3 authored by Marek Szuba's avatar Marek Szuba
Browse files

Get rid of no-longer-needed FIXME notes

parent 671df1a0
......@@ -351,7 +351,6 @@ sub store {
my @columns = qw{ transcript_id seq_start start_exon_id seq_end end_exon_id };
# FIXME: maybe we do need a separate adaptor for this after all
my @canned_columns = ( 'rnaproduct_type_id' );
my @canned_values
= ( '(SELECT rnaproduct_type_id FROM rnaproduct_type WHERE code=?)' );
......@@ -431,7 +430,6 @@ sub _list_dbIDs {
my ($self, $table, $column) = @_;
my $ids;
if($self->is_multispecies()) {
# FIXME: test this, it might not have been fully converted from TranslationAdaptor yet
$column ||= "${table}_id";
my $sql = <<"SQL";
select `rp`.`${column}`
......@@ -439,7 +437,7 @@ from rnaproduct rp
join transcript t using (transcript_id)
join seq_region sr using (seq_region_id)
join coord_system cs using (coord_system_id)
where cs.species_id =?
where cs.species_id = ?
SQL
return $self->dbc()->sql_helper()->execute_simple(-SQL => $sql, -PARAMS => [$self->species_id()]);
}
......
......@@ -167,8 +167,9 @@ sub add_Attributes {
throw("Argument to add_Attribute must be a Bio::EnsEMBL::Attribute");
}
push (@{$self->{'attributes'}}, $attrib);
# FIXME: why is this here???
$self->{seq}=undef;
# Invalidate the current sequence string in case the new attribute is a SeqEdit
$self->{seq} = undef;
}
return;
......
......@@ -271,7 +271,6 @@ subtest 'fetch_all_by_type() functionality' => sub {
# At the moment we have only got miRNA in the homo_sapiens test database
# FIXME: compare this to the total number of RNAProducts?
$n_rps = scalar @{$rp_a->fetch_all_by_type('miRNA')};
cmp_ok($n_rps, '>', 0, 'Got non-empty list of miRNA rnaproducts');
$n_rps = scalar @{$rp_a->fetch_all_by_type('generic')};
......@@ -290,10 +289,6 @@ isa_ok($rp, 'Bio::EnsEMBL::MicroRNA', 'miRNA object from database');
is($rp->type_code(), $type_mapper->class_to_type_code(ref($rp)),
'MicroRNA object has expected type code');
# FIXME: perform an in-depth inspection of one of the fetched RNAProducts,
# to make sure new_fast() call all of these fetch methods use does what it
# is supposed to do.
is($rp->seq(), 'AAAAACCCAGGAATCACCTGGA', 'Can retrieve associated sequence');
# Do not check any data inside the Transcript object, it is not our job to
......@@ -304,7 +299,8 @@ isnt($rp->transcript(), undef, 'Can retrieve associated Transcript object');
$rp->transcript(undef);
isnt($rp->transcript(), undef, 'Transcript association can be built on demand for valid dbID');
# FIXME: might want to add tests for the reverse strand as well
# FIXME: Add tests for the reverse strand as well once we have got
# some meaningful data in the test database.
is($rp->genomic_start(), $rp->transcript()->start() + $rp->start() - 1,
'genomic_start() gives correct values (forward strand)');
is($rp->genomic_end(), $rp->transcript()->start() + $rp->end() - 1,
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment