Get rid of no-longer-needed FIXME notes

modules/Bio/EnsEMBL/DBSQL/RNAProductAdaptor.pm

@@ -351,7 +351,6 @@ sub store {
 
   my @columns = qw{ transcript_id seq_start start_exon_id seq_end end_exon_id };
 
-  # FIXME: maybe we do need a separate adaptor for this after all
   my @canned_columns = ( 'rnaproduct_type_id' );
   my @canned_values
     = ( '(SELECT rnaproduct_type_id FROM rnaproduct_type WHERE code=?)' );
@@ -431,7 +430,6 @@ sub _list_dbIDs {
   my ($self, $table, $column) = @_;
   my $ids;
   if($self->is_multispecies()) {
-    # FIXME: test this, it might not have been fully converted from TranslationAdaptor yet
     $column ||= "${table}_id";
     my $sql = <<"SQL";
 select `rp`.`${column}`
@@ -439,7 +437,7 @@ from rnaproduct rp
 join transcript t using (transcript_id)
 join seq_region sr using (seq_region_id)
 join coord_system cs using (coord_system_id)
-where cs.species_id =?
+where cs.species_id = ?
 SQL
     return $self->dbc()->sql_helper()->execute_simple(-SQL => $sql, -PARAMS => [$self->species_id()]);
   }

modules/Bio/EnsEMBL/RNAProduct.pm

@@ -167,8 +167,9 @@ sub add_Attributes {
       throw("Argument to add_Attribute must be a Bio::EnsEMBL::Attribute");
     }
     push (@{$self->{'attributes'}}, $attrib);
-    # FIXME: why is this here???
-    $self->{seq}=undef;
+
+    # Invalidate the current sequence string in case the new attribute is a SeqEdit
+    $self->{seq} = undef;
   }
 
   return;

modules/t/rnaProduct.t

@@ -271,7 +271,6 @@ subtest 'fetch_all_by_type() functionality' => sub {
 
   # At the moment we have only got miRNA in the homo_sapiens test database
 
-  # FIXME: compare this to the total number of RNAProducts?
   $n_rps = scalar @{$rp_a->fetch_all_by_type('miRNA')};
   cmp_ok($n_rps, '>', 0, 'Got non-empty list of miRNA rnaproducts');
   $n_rps = scalar @{$rp_a->fetch_all_by_type('generic')};
@@ -290,10 +289,6 @@ isa_ok($rp, 'Bio::EnsEMBL::MicroRNA', 'miRNA object from database');
 is($rp->type_code(), $type_mapper->class_to_type_code(ref($rp)),
    'MicroRNA object has expected type code');
 
-# FIXME: perform an in-depth inspection of one of the fetched RNAProducts,
-# to make sure new_fast() call all of these fetch methods use does what it
-# is supposed to do.
-
 is($rp->seq(), 'AAAAACCCAGGAATCACCTGGA', 'Can retrieve associated sequence');
 
 # Do not check any data inside the Transcript object, it is not our job to
@@ -304,7 +299,8 @@ isnt($rp->transcript(), undef, 'Can retrieve associated Transcript object');
 $rp->transcript(undef);
 isnt($rp->transcript(), undef, 'Transcript association can be built on demand for valid dbID');
 
-# FIXME: might want to add tests for the reverse strand as well
+# FIXME: Add tests for the reverse strand as well once we have got
+# some meaningful data in the test database.
 is($rp->genomic_start(), $rp->transcript()->start() + $rp->start() - 1,
    'genomic_start() gives correct values (forward strand)');
 is($rp->genomic_end(), $rp->transcript()->start() + $rp->end() - 1,