Commit 5bd0fbd3 authored by Marek Szuba's avatar Marek Szuba
Browse files

Get rid of no-longer-needed FIXME notes

parent 671df1a0
...@@ -351,7 +351,6 @@ sub store { ...@@ -351,7 +351,6 @@ sub store {
my @columns = qw{ transcript_id seq_start start_exon_id seq_end end_exon_id }; my @columns = qw{ transcript_id seq_start start_exon_id seq_end end_exon_id };
# FIXME: maybe we do need a separate adaptor for this after all
my @canned_columns = ( 'rnaproduct_type_id' ); my @canned_columns = ( 'rnaproduct_type_id' );
my @canned_values my @canned_values
= ( '(SELECT rnaproduct_type_id FROM rnaproduct_type WHERE code=?)' ); = ( '(SELECT rnaproduct_type_id FROM rnaproduct_type WHERE code=?)' );
...@@ -431,7 +430,6 @@ sub _list_dbIDs { ...@@ -431,7 +430,6 @@ sub _list_dbIDs {
my ($self, $table, $column) = @_; my ($self, $table, $column) = @_;
my $ids; my $ids;
if($self->is_multispecies()) { if($self->is_multispecies()) {
# FIXME: test this, it might not have been fully converted from TranslationAdaptor yet
$column ||= "${table}_id"; $column ||= "${table}_id";
my $sql = <<"SQL"; my $sql = <<"SQL";
select `rp`.`${column}` select `rp`.`${column}`
...@@ -439,7 +437,7 @@ from rnaproduct rp ...@@ -439,7 +437,7 @@ from rnaproduct rp
join transcript t using (transcript_id) join transcript t using (transcript_id)
join seq_region sr using (seq_region_id) join seq_region sr using (seq_region_id)
join coord_system cs using (coord_system_id) join coord_system cs using (coord_system_id)
where cs.species_id =? where cs.species_id = ?
SQL SQL
return $self->dbc()->sql_helper()->execute_simple(-SQL => $sql, -PARAMS => [$self->species_id()]); return $self->dbc()->sql_helper()->execute_simple(-SQL => $sql, -PARAMS => [$self->species_id()]);
} }
......
...@@ -167,8 +167,9 @@ sub add_Attributes { ...@@ -167,8 +167,9 @@ sub add_Attributes {
throw("Argument to add_Attribute must be a Bio::EnsEMBL::Attribute"); throw("Argument to add_Attribute must be a Bio::EnsEMBL::Attribute");
} }
push (@{$self->{'attributes'}}, $attrib); push (@{$self->{'attributes'}}, $attrib);
# FIXME: why is this here???
$self->{seq}=undef; # Invalidate the current sequence string in case the new attribute is a SeqEdit
$self->{seq} = undef;
} }
return; return;
......
...@@ -271,7 +271,6 @@ subtest 'fetch_all_by_type() functionality' => sub { ...@@ -271,7 +271,6 @@ subtest 'fetch_all_by_type() functionality' => sub {
# At the moment we have only got miRNA in the homo_sapiens test database # At the moment we have only got miRNA in the homo_sapiens test database
# FIXME: compare this to the total number of RNAProducts?
$n_rps = scalar @{$rp_a->fetch_all_by_type('miRNA')}; $n_rps = scalar @{$rp_a->fetch_all_by_type('miRNA')};
cmp_ok($n_rps, '>', 0, 'Got non-empty list of miRNA rnaproducts'); cmp_ok($n_rps, '>', 0, 'Got non-empty list of miRNA rnaproducts');
$n_rps = scalar @{$rp_a->fetch_all_by_type('generic')}; $n_rps = scalar @{$rp_a->fetch_all_by_type('generic')};
...@@ -290,10 +289,6 @@ isa_ok($rp, 'Bio::EnsEMBL::MicroRNA', 'miRNA object from database'); ...@@ -290,10 +289,6 @@ isa_ok($rp, 'Bio::EnsEMBL::MicroRNA', 'miRNA object from database');
is($rp->type_code(), $type_mapper->class_to_type_code(ref($rp)), is($rp->type_code(), $type_mapper->class_to_type_code(ref($rp)),
'MicroRNA object has expected type code'); 'MicroRNA object has expected type code');
# FIXME: perform an in-depth inspection of one of the fetched RNAProducts,
# to make sure new_fast() call all of these fetch methods use does what it
# is supposed to do.
is($rp->seq(), 'AAAAACCCAGGAATCACCTGGA', 'Can retrieve associated sequence'); is($rp->seq(), 'AAAAACCCAGGAATCACCTGGA', 'Can retrieve associated sequence');
# Do not check any data inside the Transcript object, it is not our job to # Do not check any data inside the Transcript object, it is not our job to
...@@ -304,7 +299,8 @@ isnt($rp->transcript(), undef, 'Can retrieve associated Transcript object'); ...@@ -304,7 +299,8 @@ isnt($rp->transcript(), undef, 'Can retrieve associated Transcript object');
$rp->transcript(undef); $rp->transcript(undef);
isnt($rp->transcript(), undef, 'Transcript association can be built on demand for valid dbID'); isnt($rp->transcript(), undef, 'Transcript association can be built on demand for valid dbID');
# FIXME: might want to add tests for the reverse strand as well # FIXME: Add tests for the reverse strand as well once we have got
# some meaningful data in the test database.
is($rp->genomic_start(), $rp->transcript()->start() + $rp->start() - 1, is($rp->genomic_start(), $rp->transcript()->start() + $rp->start() - 1,
'genomic_start() gives correct values (forward strand)'); 'genomic_start() gives correct values (forward strand)');
is($rp->genomic_end(), $rp->transcript()->start() + $rp->end() - 1, is($rp->genomic_end(), $rp->transcript()->start() + $rp->end() - 1,
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment