From b4a91b0ce00e9508cacaa77ce9b81d3faa8d7cf5 Mon Sep 17 00:00:00 2001
From: Glenn Proctor <gp1@sanger.ac.uk>
Date: Mon, 27 Jun 2005 12:12:58 +0000
Subject: [PATCH] Simple parser for Agilent probe data.
---
.../xref_mapping/XrefParser/AgilentParser.pm | 75 +++++++++++++++++++
1 file changed, 75 insertions(+)
create mode 100644 misc-scripts/xref_mapping/XrefParser/AgilentParser.pm
diff --git a/misc-scripts/xref_mapping/XrefParser/AgilentParser.pm b/misc-scripts/xref_mapping/XrefParser/AgilentParser.pm
new file mode 100644
index 0000000000..6c15006af8
--- /dev/null
+++ b/misc-scripts/xref_mapping/XrefParser/AgilentParser.pm
@@ -0,0 +1,75 @@
+package XrefParser::AgilentParser;
+
+use strict;
+use File::Basename;
+
+use XrefParser::BaseParser;
+
+use vars qw(@ISA);
+@ISA = qw(XrefParser::BaseParser);
+
+# OParser for FASTA-format probe mappings from Agilent
+# >A_23_P253586
+# CTGTCAGGATTCTAGAACTTCTAAAATTAAAGTTTGGGGAAATCAGTAGCTCTGATGAGA
+# >A_23_P217507
+# AGAAAGACGTTTTCCAACATGTAGAACTGCTTTTTAACTGGAGGAAAAATACTTCAGGAG
+
+sub run {
+
+ my ($self, $file, $source_id, $species_id) = @_;
+
+ my @xrefs;
+
+ local $/ = "\n>";
+
+ open(AG,"<".$file) || die "Could not open $file\n";
+
+ while (<AG>) {
+
+ chomp;
+
+ my $xref;
+
+ # strip ^M at end of line
+ $_ =~ s/\015//g;
+ my ($header, $sequence) = $_ =~ /^>?(.+)\n([^>]*)/s or warn("Can't parse FASTA entry: $_\n");
+ my $probe = $header;
+
+ # note header may need to be parsed further in future
+
+ # make sequence into one long string (probably not needed for probes, but just in case)
+ $sequence =~ s/\n//g;
+
+ # build the xref object and store it
+ $xref->{ACCESSION} = $probe;
+ $xref->{LABEL} = $probe;
+ $xref->{SEQUENCE} = $sequence;
+ $xref->{SOURCE_ID} = $source_id;
+ $xref->{SPECIES_ID} = $species_id;
+ $xref->{SEQUENCE_TYPE} = 'dna';
+ $xref->{STATUS} = 'experimental';
+
+ push @xrefs, $xref;
+
+ }
+
+ close(AG);
+
+ print scalar(@xrefs) . " Agilent xrefs succesfully parsed\n";
+
+ XrefParser::BaseParser->upload_xref_object_graphs(\@xrefs);
+
+ print "Done\n";
+
+}
+
+
+sub new {
+
+ my $self = {};
+ bless $self, "XrefParser::AgilentParser";
+ return $self;
+
+}
+
+1;
--
GitLab