From ed3fcdb79ded1fb98a499b6333e1b97e746640f8 Mon Sep 17 00:00:00 2001
From: Felix Kokocinski <fsk@sanger.ac.uk>
Date: Thu, 8 Feb 2007 16:42:06 +0000
Subject: [PATCH] better store() test
---
.../EnsEMBL/Map/DBSQL/DitagFeatureAdaptor.pm | 15 ++++++++++-
modules/t/ditagFeatureAdaptor.t | 26 ++++++++++++++++---
2 files changed, 37 insertions(+), 4 deletions(-)
diff --git a/modules/Bio/EnsEMBL/Map/DBSQL/DitagFeatureAdaptor.pm b/modules/Bio/EnsEMBL/Map/DBSQL/DitagFeatureAdaptor.pm
index f181d8c43a..a5a6917f20 100644
--- a/modules/Bio/EnsEMBL/Map/DBSQL/DitagFeatureAdaptor.pm
+++ b/modules/Bio/EnsEMBL/Map/DBSQL/DitagFeatureAdaptor.pm
@@ -463,13 +463,19 @@ TAG:
throw( "Object must be an Ensembl DitagFeature, "
. "not a " . ref($ditag) );
}
-
if ( $ditag->is_stored($db) ) {
warning( "DitagFeature " . $ditag->dbID .
" is already stored in this database,".
" maybe you ned to use the update() method." );
next TAG;
}
+ if(!$ditag->ditag_id or !($self->db->get_DitagAdaptor->fetch_by_dbID($ditag->ditag_id))){
+ throw("DitagFeature must be supplied with the id of a corresponding Ditag object.");
+ }
+ if(!$ditag->ditag or !$ditag->ditag->isa("Bio::EnsEMBL::Map::Ditag")){
+ throw("DitagFeature must be linked to a valid Ditag object.");
+ }
+
# #check if more than x tags with this ditag id exist
# $sth3->execute( $ditag->ditag_id );
@@ -566,6 +572,13 @@ sub batch_store {
throw( "Object must be an Ensembl DitagFeature, "
. "not a " . ref($ditag) );
}
+ if(!$ditag->ditag_id or !($self->db->get_DitagAdaptor->fetch_by_dbID($ditag->ditag_id))){
+ throw("DitagFeature must be supplied with the id of a corresponding Ditag object.");
+ }
+
+ if(!$ditag->ditag or !$ditag->ditag->isa("Bio::EnsEMBL::Map::Ditag")){
+ throw("DitagFeature must be linked to a valid Ditag object.");
+ }
if ( $ditag->is_stored($db) ) {
warning( "DitagFeature " . $ditag->dbID
. " is already stored in this database." );
diff --git a/modules/t/ditagFeatureAdaptor.t b/modules/t/ditagFeatureAdaptor.t
index 74da4c6314..240e4414f0 100644
--- a/modules/t/ditagFeatureAdaptor.t
+++ b/modules/t/ditagFeatureAdaptor.t
@@ -15,7 +15,7 @@ my $multi = Bio::EnsEMBL::Test::MultiTestDB->new();
my $db = $multi->get_DBAdaptor( 'core' );
my $region = '11';
-my $ditag_id = 1;
+my $ditag_id = 3278356;
my $qstart = 83225874;
my $qend = 83236347;
my $qstrand = -1;
@@ -56,7 +56,7 @@ my $feature = Bio::EnsEMBL::Map::DitagFeature->new(
-hit_start => $tstart,
-hit_end => $tend,
-hit_strand => $tstrand,
- -ditag_id => $ditag_id,
+ -ditag_id => undef,
-ditag_side => $ditag_side,
-ditag_pair_id => $ditag_pair_id,
-cigar_line => $cigar_line,
@@ -73,15 +73,35 @@ ok($feature && $feature->isa('Bio::EnsEMBL::Map::DitagFeature'));
#hide the contents of ditag_feature table
$multi->hide('core', 'ditag_feature');
+$multi->hide('core', 'ditag');
+
+#create a ditag object to attach to the ditagFeature object fist
+my $name = "101A01-2";
+my $type = "ZZ13";
+my $tag_count = 2;
+my $sequence = "GAGAACTTGGACCGCAGAGAATACACACAAATCAAACC";
+my $new_ditag = Bio::EnsEMBL::Map::Ditag->new (
+ -name => $name,
+ -type => $type,
+ -count => $tag_count,
+ -sequence => $sequence,
+ );
+my @ditags = ( $new_ditag );
+$db->get_DitagAdaptor->store(\@ditags);
+
+#attach to ditagFeature
+$feature->ditag($new_ditag);
+$feature->ditag_id($new_ditag->dbID);
$dfa->store($feature);
-ok($feature->dbID && $feature->adaptor == $dfa);
+ok(defined $feature->dbID && $feature->adaptor == $dfa);
my $testfeature = $dfa->fetch_by_dbID($feature->dbID);
ok($testfeature && $testfeature->isa('Bio::EnsEMBL::Map::DitagFeature'));
#unhide table
$multi->restore('core', 'ditag_feature');
+$multi->restore('core', 'ditag');
########
# 5-11 #
--
GitLab