This project is mirrored from https://:*****@github.com/Ensembl/ensembl.git. Pull mirroring updated .
  1. 18 Mar, 2002 6 commits
  2. 15 Mar, 2002 6 commits
    • Simon Potter's avatar
      Mods so that RepeatConsensus and Repeat Feature work happily · 9faa4f86
      Simon Potter authored
      together. Probably some cleaning/tidying still to do ...
      Not as pretty as James' original code :-(
      
      
      First repeat feature on main trunk! She is 'MIR':
      
      repeat_feature_id: 1
              contig_id: 311
           contig_start: 384
             contig_end: 538
          contig_strand: 1
            analysis_id: 1
           repeat_start: 47
             repeat_end: 207
              repeat_id: 11787
                  score: 415
      1 row in set (0.05 sec)
      
      and her consensus sequence is:
      
             repeat_id: 11787
           repeat_name: MIR
          repeat_class: SINE/MIR
      repeat_consensus:
      ACAGTATAGCATAGTGGTTAAGAGCACGGACTCTGGAGCCAGACTGCCTGGGTTCGAATCCCGGCTCTGCCACTTACTAGCTGTGTGACCTTGGGCAAGTTACTTAACCTCTCTGTGCCTCAGTTTCCTCATCTGTAAAATGGGGATAATAATAGTACCTACCTCATAGGGTTGTTGTGAGGATTAAATGAGTTAATACATGTAAAGCGCTTAGAACAGTGCCTGGCACATAGTAAGCGCTCAATAAATGTTGGTTATTATT
      9faa4f86
    • Simon Potter's avatar
      876935a0
    • Simon Potter's avatar
      removed 'cache' bugs · 09f22a4f
      Simon Potter authored
      09f22a4f
    • Simon Potter's avatar
      s/insertid/mysql_insertid/ · 24bb9ce8
      Simon Potter authored
      added 'score' to RepeatFeatureAdaptor
      24bb9ce8
    • Simon Potter's avatar
      typo · de8986fa
      Simon Potter authored
      de8986fa
    • Simon Potter's avatar
      sql fix · 86630aef
      Simon Potter authored
      86630aef
  3. 14 Mar, 2002 1 commit
  4. 13 Mar, 2002 3 commits
  5. 11 Mar, 2002 4 commits
  6. 08 Mar, 2002 1 commit
  7. 07 Mar, 2002 1 commit
  8. 06 Mar, 2002 2 commits
  9. 05 Mar, 2002 2 commits
  10. 04 Mar, 2002 2 commits
  11. 01 Mar, 2002 9 commits
  12. 28 Feb, 2002 3 commits