use strict; use warnings; use Test::More; use Bio::EnsEMBL::Test::TestUtils; use IO::String; use Bio::EnsEMBL::Test::MultiTestDB; use Bio::EnsEMBL::Slice; use Bio::EnsEMBL::ProjectionSegment; use Test::Exception; our $verbose = 0; # # TEST - Slice Compiles # ok(1); my $CHR = '20'; my $START = 30_270_000; my $END = 31_200_000; my $STRAND = 1; my $SEQ_REGION_LENGTH = 50e6; my $multi_db = Bio::EnsEMBL::Test::MultiTestDB->new; my $db = $multi_db->get_DBAdaptor('core'); # # TEST - Slice creation from adaptor # my $slice_adaptor = $db->get_SliceAdaptor; my $csa = $db->get_CoordSystemAdaptor(); my $slice = $slice_adaptor->fetch_by_region('chromosome', $CHR, $START, $END); ok($slice->seq_region_name eq $CHR); ok($slice->start == $START); ok($slice->end == $END); ok($slice->seq_region_length == 62842997); ok($slice->adaptor == $slice_adaptor); # #TEST - Slice::new # my $coord_system = $csa->fetch_by_name('chromosome'); my $test_seq = 'ATGCATGCATGCATGCATGCATGC'; my $test_slice = new Bio::EnsEMBL::Slice (-seq_region_name => 'misc', -seq_region_length => 24, -start => 1, -end => 24, -strand => 1, -coord_system => $coord_system, -seq => $test_seq, ); ok($test_slice->length == 24); my $hash = $test_slice->get_base_count; my $a = $hash->{'a'}; my $c = $hash->{'c'}; my $t = $hash->{'t'}; my $g = $hash->{'g'}; my $n = $hash->{'n'}; my $gc_content = $hash->{'%gc'}; ok($a == 6 && $c == 6 && $t == 6 && $g == 6 && $n == 0 && $gc_content == 50 && $a+$c+$t+$g+$n == $test_slice->length); # # test that subseq works correctly with attached sequence # my $subseq = $test_slice->subseq(2, 6); debug("subseq = $subseq"); ok($subseq eq 'TGCAT'); $subseq = $test_slice->subseq(2,6,-1); ok($subseq eq 'ATGCA'); debug("subseq = $subseq"); # test that subslice works correctly with attached sequence my $sub_slice = $test_slice->sub_Slice(2, 6); ok($sub_slice->seq eq 'TGCAT'); # test that invert works correctly with attached sequence ok($sub_slice->invert()->seq() eq 'ATGCA'); # test that slice can be created without db, seq or coord system { my $warnings = q{}; my $new_stderr = IO::String->new(\$warnings); my $oldfh = select(STDERR); local *STDERR = $new_stderr; $test_slice = Bio::EnsEMBL::Slice->new('-seq_region_name' => 'test', '-start' => 1, '-end' => 3); my $check = qr/MSG: Slice without coordinate system/; like($warnings, $check, 'Checking we are still warning about lack of coordinate system'); } ok($test_slice); ok($test_slice->seq() eq 'NNN'); debug("\$test_slice->name = " . $test_slice->name()); ok($test_slice->name() eq '::test:1:3:1'); $slice = new Bio::EnsEMBL::Slice (-seq_region_name => $CHR, -seq_region_length => $SEQ_REGION_LENGTH, -start => $START, -end => $END, -strand => $STRAND, -coord_system => $coord_system); ok($slice->seq_region_name eq $CHR); ok($slice->start == $START); ok($slice->end == $END); ok($slice->strand == $STRAND); ok($slice->seq_region_length == $SEQ_REGION_LENGTH); # #Test - Slice::adaptor # $slice->adaptor($slice_adaptor); ok($slice->adaptor == $slice_adaptor); # #1 Test Slice::name # #verify that chr_name start and end are contained in the name my $name = $slice->name; ok($name eq "chromosome:NCBI33:$CHR:$START:$END:$STRAND"); # # Test Slice::length # ok($slice->length == ($END-$START + 1)); # Test exception name is($slice->assembly_exception_type(), 'REF', 'Type of region is REF'); # # Test get_attributes # my $clone = $slice_adaptor->fetch_by_region('clone','AL121583.25'); my @attrib = @{$clone->get_all_Attributes('htg_phase')}; ok(@attrib == 1 && $attrib[0]->value() == 4); # # Test expand # my $len = $clone->length(); $clone = $clone->expand(100,100); ok(($clone->start == -99) && ($clone->end() == $len+100)); $clone = $clone->expand(-100,-100); ok(($clone->start == 1) && ($clone->end() == $len)); $clone = $clone->expand(0,1000); ok(($clone->start == 1) && ($clone->end() == $len + 1000)); $clone = $clone->expand(-1000, 0); ok(($clone->start == 1001) && ($clone->end() == $len + 1000)); # # Test constrain_to_seq_region # my $tidy_clone = $clone->expand(1000000,10000000); $tidy_clone = $tidy_clone->constrain_to_seq_region; ok($tidy_clone->start == 1 && $tidy_clone->end == 84710, 'Huge expand call truncates nicely'); $tidy_clone = $clone->expand(0,-1000); $tidy_clone = $tidy_clone->constrain_to_seq_region; note($tidy_clone->start."-".$tidy_clone->end()); ok(($tidy_clone->start == 1001) && ($tidy_clone->end() == 84710), 'constrain_to_seq_region does no harm'); # # Test Slice::invert # my $inverted_slice = $slice->invert; ok($slice != $inverted_slice); #slice is not same object as inverted slice #inverted slice on opposite strand ok($slice->strand == ($inverted_slice->strand * -1)); #slice still on same strand ok($slice->strand == $STRAND); # # Test Slice::seq # my $seq = uc $slice->seq; my $invert_seq = uc $slice->invert->seq; ok(length($seq) == $slice->length); #sequence is correct length $seq = reverse $seq; #reverse complement seq $seq =~ tr/ACTG/TGAC/; ok($seq eq $invert_seq); #revcom same as seq on inverted slice # # Test Slice::subseq # my $SPAN = 10; my $sub_seq = uc $slice->subseq(-$SPAN,$SPAN); my $invert_sub_seq = uc $slice->invert->subseq( $slice->length - $SPAN + 1, $slice->length + $SPAN + 1); ok(length $sub_seq == (2*$SPAN) + 1 ); $sub_seq = reverse $sub_seq; $sub_seq =~ tr/ACTG/TGAC/; ok($sub_seq eq $invert_sub_seq); # # Test Slice::get_all_PredictionTranscripts # my $pts = $slice->get_all_PredictionTranscripts; ok(@$pts == 24); # # Test Slice::get_seq_region_id # ok($slice->get_seq_region_id()); # # Test Slice::get_all_DnaAlignFeatures # my $count = 0; my $dafs = $slice->get_all_DnaAlignFeatures; is(scalar(@$dafs), 27081, 'Checking count of returned DnaAlignFeatures'); $count += scalar @$dafs; # # Test Slice::get_all_ProteinAlignFeatures # my $pafs = $slice->get_all_ProteinAlignFeatures; is(scalar(@$pafs),7205, 'Checking count of returned ProteinAlignFeatures'); $count += scalar @$pafs; # # Test Slice::get_all_SimilarityFeatures # ok($count == scalar @{$slice->get_all_SimilarityFeatures}); # # Test Slice::get_all_SimpleFeatures # ok(scalar @{$slice->get_all_SimpleFeatures}); # # Test Slice::get_all_RepeatFeatures # ok(scalar @{$slice->get_all_RepeatFeatures}); # # Test Slice::get_all_Genes # ok(scalar @{$slice->get_all_Genes}); # # Test Slice::get_all_Genes_by_type # ok(scalar @{$slice->get_all_Genes_by_type('protein_coding')}); # # Test Slice::get_all_Transcripts # ok(scalar @{$slice->get_all_Transcripts}); # # Test Slice::get_all_KaryotypeBands # ok(scalar @{$slice->get_all_KaryotypeBands}); # # Test Slice::get_RepeatMaskedSeq # $seq = $slice->seq; ok(length($slice->get_repeatmasked_seq->seq) == length($seq)); my $softmasked_seq = $slice->get_repeatmasked_seq(['RepeatMask'], 1)->seq; ok($softmasked_seq ne $seq); ok(uc($softmasked_seq) eq $seq); $softmasked_seq = $seq = undef; # # Test Slice::get_all_MiscFeatures # ok(scalar @{$slice->get_all_MiscFeatures()}); # # Test Slice::project # my @segments = @{$slice->project( 'seqlevel' )}; ok(scalar @segments ); eval { my @sub_slices = map { $_->to_Slice() } @segments; my @starts = map { $_->from_start() } @segments; my @ends = map { $_->from_end() } @segments; }; if( $@ ) { debug( "to_Slice call failed on segment of projection" ); ok(0); } else { ok(1) } #my $super_slices = $slice->get_all_supercontig_Slices(); ## ## get_all_supercontig_Slices() ## #debug( "Supercontig starts at ".$super_slices->[0]->chr_start() ); #ok( $super_slices->[0]->chr_start() == 29591966 ); #debug( "Supercontig name ".$super_slices->[0]->name() ); #ok( $super_slices->[0]->name() eq "NT_028392" ); # # get_base_count # $hash = $slice->get_base_count; $a = $hash->{'a'}; $c = $hash->{'c'}; $t = $hash->{'t'}; $g = $hash->{'g'}; $n = $hash->{'n'}; $gc_content = $hash->{'%gc'}; debug( "Base count: a=$a c=$c t=$t g=$g n=$n \%gc=$gc_content"); ok($a == 234371 && $c == 224761 && $t == 243734 && $g == 227135 && $n == 0 && $gc_content == 48.59 && $a+$c+$t+$g+$n == $slice->length); $slice = $slice_adaptor->fetch_by_region('chromosome', '20', 10, 30); my $sr_slice = $slice->seq_region_Slice(); ok($sr_slice->start() == 1 && $sr_slice->end() == $slice->seq_region_length() && $sr_slice->strand() == 1); # synonym tests debug("START syn test"); my $multi = $multi_db; $multi->save("core", "seq_region_synonym"); debug("get slice"); $slice = $slice_adaptor->fetch_by_region('chromosome', 20, 1, 10); my @alt_names = @{$slice->get_all_synonyms()}; foreach my $syn (@alt_names){ debug("syn\t".$syn->name."\n"); } debug("altnames ".scalar(@alt_names)."\n"); ok(@alt_names == 2); $slice->add_synonym("20ish"); @alt_names = @{$slice->get_all_synonyms()}; ok(@alt_names == 3); #slcie aleady stored so need to store syns my $syn_adap = $db->get_SeqRegionSynonymAdaptor; foreach my $syn (@alt_names){ $syn_adap->store($syn); } $slice = $slice_adaptor->fetch_by_region('chromosome', 20, 1, 10); @alt_names = @{$slice->get_all_synonyms()}; ok(@alt_names == 3); $multi->restore(); $multi->save("core", 'seq_region_synonym'); $slice = $slice_adaptor->fetch_by_region('chromosome', 1, 1, 10); @alt_names = @{$slice->get_all_synonyms()}; ok(@alt_names == 0); $slice->add_synonym("1ish"); @alt_names = @{$slice->get_all_synonyms()}; ok(@alt_names == 1); foreach my $syn (@alt_names){ $syn_adap->store($syn); } $slice = $slice_adaptor->fetch_by_region('chromosome', 1, 1, 10); @alt_names = @{$slice->get_all_synonyms()}; ok(@alt_names == 1); $multi->restore(); # Testing synonym searching { my $chr_20 = $slice_adaptor->fetch_by_region('chromosome', 20); my ($syn) = @{$chr_20->get_all_synonyms('RFAM')}; is($syn->name(), 'anoth_20', 'We have the right synonym'); dies_ok { $chr_20->get_all_synonyms('RFAM', 'wibble') } 'Bad external DB version means dying code'; dies_ok { $chr_20->get_all_synonyms('RFAMing', 'wibble') } 'Bad external DB name means dying code'; ($syn) = @{$chr_20->get_all_synonyms('RFAM', 1)}; is($syn->name(), 'anoth_20', 'We have the right synonym'); } #Test assembly exception type on HAP my $hap_slice = $slice_adaptor->fetch_by_region(undef, '20_HAP1'); is($hap_slice->assembly_exception_type(), 'HAP', 'Ensuring haplotype regions are HAP'); my $chr_one_slice = $slice_adaptor->fetch_by_region('chromosome', '1', 1, 10); is($chr_one_slice->assembly_exception_type(), 'REF', 'Ensuring reference regions are REF'); #Test slice iterator { my $large_slice = $slice_adaptor->fetch_by_region('chromosome', 1, 1, 21); my $map = sub { $_->length() }; my $si = sub { my ($chunk) = @_; return $large_slice->sub_Slice_Iterator($chunk)->map($map)->to_arrayref(); }; is_deeply($si->(100), [21], 'Subslice larger than actual slice gives just 1 slice back'); is_deeply($si->(10), [10,10,1], 'Subslice smaller than actual slice gives 3 slices back'); is_deeply($si->(20), [20,1], 'Subslice just smaller than actual slice gives 2 slices back'); is_deeply($si->(21), [21], 'Subslice equal to slice size gives 1 slice back'); my $slice_count = $large_slice->sub_Slice_Iterator(1)->reduce(sub { $_[0]+1 }, 0); is($slice_count, 21, 'Giving a subslice size of 1 means 21 slices'); { my $fake_slice = Bio::EnsEMBL::Slice->new(-SEQ => 'AAACCCTTTGGGA', -START => 1, -END => 13, -SEQ_REGION_NAME => 'fake', -COORD_SYSTEM => $coord_system); my $subseqs = $fake_slice->sub_Slice_Iterator(3)->map(sub { $_->seq() })->to_arrayref(); my $expected = ['AAA','CCC','TTT','GGG','A']; is_deeply($subseqs, $expected, 'Calling seq on subslices returns only the sequence for the bounds'); } { my $one_bp_slice = Bio::EnsEMBL::Slice->new(-SEQ => 'A', -START => 1, -END => 1, -SEQ_REGION_NAME => 'fake', -COORD_SYSTEM => $coord_system); my $subseqs = $one_bp_slice->sub_Slice_Iterator(1)->map(sub { $_->seq() })->to_arrayref(); my $expected = ['A']; is_deeply($subseqs, $expected, 'Calling seq on subslices for 1bp slice returns only an A'); } } done_testing();