Skip to content
Snippets Groups Projects
slice.t 6.72 KiB
Newer Older
BEGIN { $| = 1;
	plan tests => 48;
use TestUtils qw( debug );
use Bio::EnsEMBL::ProjectionSegment;
our $verbose= 0;
# TEST - Slice Compiles
Graham McVicker's avatar
Graham McVicker committed
my $START         = 30_270_000;
my $SEQ_REGION_LENGTH = 50e6;
my $multi_db = MultiTestDB->new;
my $db = $multi_db->get_DBAdaptor('core');
# TEST - Slice creation from adaptor
#
my $slice_adaptor = $db->get_SliceAdaptor;
my $csa = $db->get_CoordSystemAdaptor();
my $slice = $slice_adaptor->fetch_by_region('chromosome', $CHR, $START, $END);
ok($slice->seq_region_name eq $CHR);
ok($slice->start == $START);
ok($slice->end == $END);
ok($slice->seq_region_length == 62842997);
ok($slice->adaptor == $slice_adaptor);
#TEST - Slice::new
my $coord_system = $csa->fetch_by_name('chromosome');

my $test_seq = 'ATGCATGCATGCATGCATGCATGC';
my $test_slice = new Bio::EnsEMBL::Slice
  (-seq_region_name  => 'misc',
   -seq_region_length => 24,
   -start            => 1,
   -end              => 24,
   -strand           => 1,
   -coord_system     => $coord_system,
   -seq              => $test_seq,
   );




ok($test_slice->length == 24);

my $hash = $test_slice->get_base_count;
my $a = $hash->{'a'};
my $c = $hash->{'c'};
my $t = $hash->{'t'};
my $g = $hash->{'g'};
my $n = $hash->{'n'};
my $gc_content = $hash->{'%gc'};

ok($a == 6
   && $c == 6 
   && $t == 6 
   && $g == 6 
   && $n == 0 
   && $gc_content == 50 
   && $a+$c+$t+$g+$n == $test_slice->length);


#
# test that subseq works correctly with attached sequence
#

my $subseq = $test_slice->subseq(2, 6);

debug("subseq = $subseq");
ok($subseq eq 'TGCAT');

$subseq = $test_slice->subseq(2,6,-1);
ok($subseq eq 'ATGCA');
debug("subseq = $subseq");


$slice = new Bio::EnsEMBL::Slice
  (-seq_region_name   => $CHR,
   -seq_region_length => $SEQ_REGION_LENGTH,
   -start             => $START,
   -end               => $END,
   -strand            => $STRAND,
   -coord_system      => $coord_system);
ok($slice->seq_region_name eq $CHR);
ok($slice->start == $START);
ok($slice->end == $END);
ok($slice->seq_region_length == $SEQ_REGION_LENGTH);
#Test - Slice::adaptor
#
$slice->adaptor($slice_adaptor);
ok($slice->adaptor == $slice_adaptor);
#1 Test Slice::name
#
#verify that chr_name start and end are contained in the name
my $name = $slice->name;
ok($name eq "chromosome:NCBI33:$CHR:$START:$END:$STRAND");

#
# Test Slice::length
#
ok($slice->length == ($END-$START + 1));
# Test get_attributes
my $clone = $slice_adaptor->fetch_by_region('clone','AL121583.25');

my @attrib = @{$clone->get_all_Attributes('htg_phase')};
ok(@attrib == 1 && $attrib[0]->value() == 4);
my $len = $clone->length();

$clone = $clone->expand(100,100);
ok(($clone->start == -99) && ($clone->end() == $len+100));

$clone = $clone->expand(-100,-100);
ok(($clone->start == 1) && ($clone->end() == $len));

$clone = $clone->expand(0,1000);
ok(($clone->start == 1) && ($clone->end() == $len + 1000));

$clone = $clone->expand(-1000, 0);
ok(($clone->start == 1001) && ($clone->end() == $len + 1000));
# Test Slice::invert
#
my $inverted_slice = $slice->invert;
ok($slice != $inverted_slice); #slice is not same object as inverted slice
#inverted slice on opposite strand
ok($slice->strand == ($inverted_slice->strand * -1)); 
#slice still on same strand
ok($slice->strand == $STRAND);
# Test Slice::seq
Graham McVicker's avatar
Graham McVicker committed
my $seq = uc $slice->seq;
my $invert_seq = uc $slice->invert->seq;
ok(length($seq) == $slice->length); #sequence is correct length
Graham McVicker's avatar
Graham McVicker committed

$seq = reverse $seq;  #reverse complement seq
$seq =~ tr/ACTG/TGAC/; 

ok($seq eq $invert_seq); #revcom same as seq on inverted slice
# Test Slice::subseq
Graham McVicker's avatar
Graham McVicker committed
my $sub_seq = uc $slice->subseq(-$SPAN,$SPAN);
my $invert_sub_seq = uc $slice->invert->subseq( $slice->length - $SPAN + 1, 
						$slice->length + $SPAN + 1);

Graham McVicker's avatar
Graham McVicker committed
$sub_seq = reverse $sub_seq;
$sub_seq =~ tr/ACTG/TGAC/;

ok($sub_seq eq $invert_sub_seq);

#
# Test Slice::get_all_PredictionTranscripts
Graham McVicker's avatar
Graham McVicker committed
#
my $pts = $slice->get_all_PredictionTranscripts;
ok(@$pts == 24);
#
# Test Slice::get_seq_region_id
#
ok($slice->get_seq_region_id());
# Test Slice::get_all_DnaAlignFeatures
Graham McVicker's avatar
Graham McVicker committed
#
my $count = 0;
my $dafs = $slice->get_all_DnaAlignFeatures;
ok(@$dafs == 27081);
Graham McVicker's avatar
Graham McVicker committed
$count += scalar @$dafs;

#
# Test Slice::get_all_ProteinAlignFeatures
Graham McVicker's avatar
Graham McVicker committed
#
my $pafs = $slice->get_all_ProteinAlignFeatures;
ok(@$pafs == 7205);
Graham McVicker's avatar
Graham McVicker committed
$count += scalar @$pafs;

#
# Test Slice::get_all_SimilarityFeatures
Graham McVicker's avatar
Graham McVicker committed
#
ok($count == scalar @{$slice->get_all_SimilarityFeatures});

#
#  Test Slice::get_all_SimpleFeatures
Graham McVicker's avatar
Graham McVicker committed
#
ok(scalar @{$slice->get_all_SimpleFeatures});

#
#  Test Slice::get_all_RepeatFeatures
Graham McVicker's avatar
Graham McVicker committed
#
ok(scalar @{$slice->get_all_RepeatFeatures});

#
#  Test Slice::get_all_Genes
Graham McVicker's avatar
Graham McVicker committed
#
ok(scalar @{$slice->get_all_Genes});

#
#  Test Slice::get_all_Genes_by_type
Graham McVicker's avatar
Graham McVicker committed
#
ok(scalar @{$slice->get_all_Genes_by_type('ensembl')});



#
# Test Slice::get_all_KaryotypeBands
Graham McVicker's avatar
Graham McVicker committed
#
ok(scalar @{$slice->get_all_KaryotypeBands});
Graham McVicker's avatar
Graham McVicker committed
#
# Test Slice::get_RepeatMaskedSeq
Graham McVicker's avatar
Graham McVicker committed
#
$seq = $slice->seq;
ok(length($slice->get_repeatmasked_seq->seq) == length($seq));

my $softmasked_seq = $slice->get_repeatmasked_seq(['RepeatMask'], 1)->seq;

ok($softmasked_seq ne $seq);
ok(uc($softmasked_seq) eq $seq);

$softmasked_seq = $seq = undef;
# Test Slice::get_all_MiscFeatures
Graham McVicker's avatar
Graham McVicker committed
#
ok(scalar @{$slice->get_all_MiscFeatures()});
# Test Slice::project
Graham McVicker's avatar
Graham McVicker committed
#

my @segments = @{$slice->project( 'seqlevel' )};
ok(scalar @segments );

eval {
  my @sub_slices = map { $_->to_Slice() } @segments;
  my @starts = map { $_->from_start() } @segments;
  my @ends = map { $_->from_end() } @segments;
};

if( $@ ) {
  debug( "to_Slice call failed on segment of projection" );
  ok(0);
} else {
  ok(1)
}
#my $super_slices = $slice->get_all_supercontig_Slices();
##
## get_all_supercontig_Slices()
##
#debug( "Supercontig starts at ".$super_slices->[0]->chr_start() );
#ok( $super_slices->[0]->chr_start() == 29591966 );
#debug( "Supercontig name ".$super_slices->[0]->name() );
#ok( $super_slices->[0]->name() eq "NT_028392" );
# get_base_count
$hash = $slice->get_base_count;
$a = $hash->{'a'};
$c = $hash->{'c'};
$t = $hash->{'t'};
$g = $hash->{'g'};
$n = $hash->{'n'};
$gc_content = $hash->{'%gc'};

debug( "Base count: a=$a c=$c t=$t g=$g n=$n \%gc=$gc_content");
ok($a == 234371 
   && $c == 224761 
   && $t == 243734 
   && $g == 227135 
   && $n == 0 
   && $gc_content == 48.59 
   && $a+$c+$t+$g+$n == $slice->length);


$slice = $slice_adaptor->fetch_by_region('chromosome', '20', 10, 30);

my $sr_slice = $slice->seq_region_Slice();

ok($sr_slice->start() == 1 &&
   $sr_slice->end()   == $slice->seq_region_length() &&
   $sr_slice->strand() == 1);