UniGene parser first attempt. Not sure it is worth downloading the .data file...

UniGene parser first attempt. Not sure it is worth downloading the .data file for the titles as it is a large file but is far easier than trying to guess from the .seq.uniq file.

misc-scripts/xref_mapping/XrefParser/UniGeneParser.pm

+# Parse UniGene Hs.seq.uniq files to create xrefs.
+
+package XrefParser::UniGeneParser;
+
+use strict;
+
+use File::Basename;
+
+use XrefParser::BaseParser;
+
+use vars qw(@ISA);
+@ISA = qw(XrefParser::BaseParser);
+
+# --------------------------------------------------------------------------------
+# Parse command line and run if being run directly
+
+if (!defined(caller())) {
+
+  if (scalar(@ARGV) != 1) {
+    print "\nUsage: UniGeneParser.pm file.SPC <source_id> <species_id>\n\n";
+    exit(1);
+  }
+
+  run($ARGV[0], -1);
+
+}
+
+# --------------------------------------------------------------------------------
+
+sub run {
+
+  my $self = shift if (defined(caller(1)));
+  my $file = shift;
+  my $source_id = shift;
+  my $species_id = shift;
+
+  my $unigene_source_id = XrefParser::BaseParser->get_source_id_for_source_name('UniGene');
+
+  print "UniGene source ID = $unigene_source_id.\n";
+
+  if(!defined($species_id)){
+    $species_id = XrefParser::BaseParser->get_species_id_for_filename($file);
+  }
+
+  XrefParser::BaseParser->upload_xref_object_graphs(create_xrefs($unigene_source_id, $unigene_source_id, $file, $species_id));
+
+}
+
+# --------------------------------------------------------------------------------
+# Parse file into array of xref objects
+# There are 2 types of RefSeq files that we are interested in:
+# - protein sequence files *.protein.faa
+# - mRNA sequence files *.rna.fna
+# Slightly different formats
+
+my %geneid_2_desc;
+
+sub get_desc{
+  my $file = shift;
+  my $dir = dirname($file);
+ 
+  print $file."\n";
+  (my $name) = $file  =~ /\/(\w+)\.seq\.uniq/;
+  print $name."\n";
+
+  local $/ = "//";
+
+
+  open (DESC, "$dir/$name.data") || die "Can't open $dir/$name.data\n";
+
+
+  my $i =0 ;
+#  my %geneid_2_desc;
+  while(<DESC>){
+    
+    #ID          Hs.159356
+    #TITLE       Hypothetical LOC388277
+    
+    (my $id) = $_ =~ /ID\s+(\S+)/;
+    (my $descrip) = $_ =~ /TITLE\s+(.+)\n/;
+
+    $geneid_2_desc{$id} = $descrip;
+#    print $id."->".$desc."\n";
+    $i++;
+    if($i < 10){
+      print $id."->".$descrip."\n";
+    }
+    
+  }
+#  return \%geneid_2_desc;
+}
+
+
+sub create_xrefs {
+
+  my ($peptide_source_id, $unigene_source_id, $file, $species_id) = @_;
+
+  my %name2species_id = XrefParser::BaseParser->name2species_id();
+
+  get_desc($file);
+
+  open(UNIGENE, $file) || die "Can't open RefSeq file $file\n";
+#>gnl|UG|Hs#S19185843 Homo sapiens N-acetyltransferase 2 (arylamine N-acetyltransferase)
+  # , mRNA (cDNA clone MGC:71963 IMAGE:4722596), complete cds /cds=(105,977) /gb=BC067218 /gi=45501306 /ug=Hs.2 /len=1344
+#GGGGACTTCCCTTGCAGACTTTGGAAGGGAGAGCACTTTATTACAGACCTTGGAAGCAAG
+
+
+  my @xrefs;
+
+  local $/ = "\n>";
+
+  while (<UNIGENE>) {
+
+    my $xref;
+
+    my $entry = $_;
+    chomp $entry;
+    my ($header, $sequence) = split (/\n/, $entry, 2);
+    $sequence =~ s/^>//;
+    # remove newlines
+    my @seq_lines = split (/\n/, $sequence);
+    $sequence = join("", @seq_lines);
+
+#    (my $gnl, my $n, my $rest) = split(/\|/, $header,3);
+
+    (my $acc_no_ver) = $header =~ /\/ug=(\S*)/;
+
+    if(!defined($geneid_2_desc{$acc_no_ver})){
+      print "****$_\n";
+      die "OOPS!! no desc for $acc_no_ver\n";
+    }
+
+
+    $xref->{SEQUENCE_TYPE} = 'dna';
+    $xref->{STATUS} = 'experimental';
+    $xref->{SOURCE_ID} = $unigene_source_id;
+   
+
+    ##No species check as files contain data  fro only one species.
+    
+    $xref->{ACCESSION} = $acc_no_ver;
+    $xref->{LABEL} = $acc_no_ver;
+    $xref->{DESCRIPTION} = $geneid_2_desc{$acc_no_ver};
+    $xref->{SEQUENCE} = $sequence;
+    $xref->{SPECIES_ID} = $species_id;
+    
+    push @xrefs, $xref;
+    
+  }
+
+  close (UNIGENE);
+  %geneid_2_desc=();
+  print "Read " . scalar(@xrefs) ." xrefs from $file\n";
+
+  return \@xrefs;
+
+}
+
+# --------------------------------------------------------------------------------
+
+sub new {
+
+  my $self = {};
+  bless $self, "XrefParser::UniGeneParser";
+  return $self;
+
+}
+
+# --------------------------------------------------------------------------------
+
+1;