added a test for repeat_Feature and repeat_consensus and added an extra analysis to testdb

modules/t/minidatabase.dump

@@ -15,6 +15,8 @@ INSERT into analysis (analysis_id,logic_name,gff_source,gff_feature) VALUES (2,"
 
 INSERT into analysis (analysis_id,logic_name,db,db_version,gff_source,gff_feature) VALUES (3,"dummy-genscan","HumanIso.mat","1","genscan","prediction");
 
+INSERT into analysis (analysis_id,logic_name,gff_source,gff_feature) VALUES (4,"dummy-repeatmask","repeatmask","repeat");
+
 INSERT into dna(dna_id, sequence, created) values(1, 'ATGATCAGTACAGTTACAGTAGACACAGATGTAG', now());
 
 

modules/t/repeatfeature.t

+use lib 't';
+
+BEGIN { $| = 1;  
+	use Test;
+	plan tests => 11;
+}
+
+my $loaded = 0;
+END {print "not ok 1\n" unless $loaded;}
+
+use EnsTestDB;
+use Bio::EnsEMBL::DBLoader;
+
+
+
+$loaded = 1;
+
+ok(1);
+
+# Database will be dropped when this
+# object goes out of scope
+my $ens_test = EnsTestDB->new;
+
+$ens_test->do_sql_file("t/minidatabase.dump");
+
+ok($ens_test);
+
+
+
+my $db = $ens_test->get_DBSQL_Obj;
+$cadp = $db->get_RawContigAdaptor();
+$contig = $cadp->fetch_by_dbID(1);
+my $analysis = $db->get_AnalysisAdaptor->fetch_by_newest_logic_name("dummy-repeatmask");
+print STDERR "ANALYSIS ".$analysis."\n";
+ok($analysis);
+ok($contig);
+
+$repeat_f_ad = $db->get_RepeatFeatureAdaptor();
+$repeat_c_ad = $db->get_RepeatConsensusAdaptor();
+
+
+print STDERR "DBID ".$analysis->dbID."\n";
+
+my $repeat_consensus = Bio::EnsEMBL::RepeatConsensus->new();
+
+$repeat_consensus->length(10);
+$repeat_consensus->repeat_class('dummy');
+$repeat_consensus->name('dummy');
+$repeat_consensus->repeat_consensus('ATGCATGCAT');
+
+ok($repeat_consensus);
+
+$repeat_c_ad->store($repeat_consensus);
+
+ok(1);
+
+my $repeat_feature = Bio::EnsEMBL::RepeatFeature->new();
+
+$repeat_feature->contig_id($contig->dbID);
+$repeat_feature->start(26);
+$repeat_feature->end(65);
+$repeat_feature->strand(1);
+$repeat_feature->hstart(6);
+$repeat_feature->hend(45);
+$repeat_feature->score(100);
+$repeat_feature->analysis($analysis);
+$repeat_feature->repeat_consensus($repeat_consensus);
+
+ok($repeat_feature);
+
+$repeat_f_ad->store($contig->dbID, $repeat_feature);
+
+ok(1);
+
+
+my @repeats = $repeat_f_ad->fetch_by_RawContig($contig);
+
+my $repeat = $repeats[0];
+
+ok($repeat);
+
+ok($repeat->start == 26);
+ok($repeat->hend == 45);
+