Commit 64e00f69 authored by Andy Yates's avatar Andy Yates
Browse files

Updating GFF parser tests

parent ee9aabdf
......@@ -79,4 +79,38 @@ GFF
}
}
{
my $string = <<GFF;
##gff-version 3
##sequence-region ctg123 1 1497228
##taken-from example parsing file with FASTA directive
ctg123\t.\tgene\t1000\t9000\t.\t+\t.\tID=gene00001;Name=EDEN
###
##FASTA
>ctg123
AACCTTTGGGCCGGGCCTTAAAA
AACC
GFF
my $io = IO::String->new(\$string);
my $gff = Bio::EnsEMBL::Utils::IO::GFFParser->new($io);
my $header = $gff->parse_header();
is_deeply(
$header,
[ '##gff-version 3', '##sequence-region ctg123 1 1497228', '##taken-from example parsing file with FASTA directive'],
'Checking headers all parse'
);
my $actual_gene = $gff->parse_next_feature();
my $expected_gene = {
seqid => 'ctg123', start => 1000, end => 9000, strand => 1,
source => '.', type => 'gene', score => '.', phase => '.',
attribute => { ID => 'gene00001', Name => 'EDEN' }
};
is_deeply($actual_gene, $expected_gene, 'Checking TF record parses');
my $id = $gff->parse_next_feature();
ok(! defined $id, 'No more features');
my $seq = $gff->parse_next_sequence();
is_deeply($seq, {header => '>ctg123', sequence => "AACCTTTGGGCCGGGCCTTAAAAAACC"}, "Checking Sequence parses correctly")
}
done_testing();
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment