Commit 4eb861ca authored by Ian Longden's avatar Ian Longden
Browse files

Keeping sql and txt unzipped now for better maintainabillity in cvs

parent a27ef2e0
CREATE TABLE `alt_allele` (
`alt_allele_id` int(11) NOT NULL auto_increment,
`gene_id` int(11) NOT NULL default '0',
UNIQUE KEY `gene_idx` (`gene_id`),
UNIQUE KEY `allele_idx` (`alt_allele_id`,`gene_id`)
) ENGINE=MyISAM DEFAULT CHARSET=latin1 COLLATE=latin1_bin;
CREATE TABLE `analysis` (
`analysis_id` int(10) unsigned NOT NULL auto_increment,
`created` datetime NOT NULL default '0000-00-00 00:00:00',
`logic_name` varchar(40) collate latin1_bin NOT NULL default '',
`db` varchar(120) collate latin1_bin default NULL,
`db_version` varchar(40) collate latin1_bin default NULL,
`db_file` varchar(120) collate latin1_bin default NULL,
`program` varchar(80) collate latin1_bin default NULL,
`program_version` varchar(40) collate latin1_bin default NULL,
`program_file` varchar(80) collate latin1_bin default NULL,
`parameters` varchar(255) collate latin1_bin default NULL,
`module` varchar(80) collate latin1_bin default NULL,
`module_version` varchar(40) collate latin1_bin default NULL,
`gff_source` varchar(40) collate latin1_bin default NULL,
`gff_feature` varchar(40) collate latin1_bin default NULL,
PRIMARY KEY (`analysis_id`),
UNIQUE KEY `logic_name` (`logic_name`),
KEY `logic_name_idx` (`logic_name`)
) ENGINE=MyISAM DEFAULT CHARSET=latin1 COLLATE=latin1_bin;
1 2000-09-08 16:10:03 RepeatMask repbase 001212 RepeatMasker 1 RepeatMasker 1 RepeatMasker repeat
2 2000-09-22 10:59:05 Genscan HumanIso.smat 1 HumanIso.smat genscan 1.0 Genscan 1 genscan prediction
5 2000-09-28 17:33:27 Swall swall 1 swall wublastp 1 -hitdist=40, -cpus=1 BlastGenscanPep wublastp similarity
7 2000-10-09 15:30:14 Vertrna embl_vertrna 1 embl_vertrna wutblastn 1 -hitdist=40, -cpus=1 BlastGenscanDNA 1 wutblastn similarity
4 2000-12-18 15:12:30 tRNAscan tRNA 1 tRNAscan-SE 1.11 tRNAscan_SE 1 tRNAscan-SE tRNA
8 2000-12-18 18:28:03 CpG cpg 1 cpg 1 CPG 1 cpg cpg_island
9 2001-01-15 17:00:00 Unigene unigene.seq 1 unigene.seq wutblastn 1 -hitdist=40, -cpus=1 BlastGenscanDNA 1 wutblastn similarity
10 2001-01-15 17:00:00 QTL 1 1 QtlPlacer 1 experimental marker
12 2001-03-28 16:42:32 dbEST dbEST 1 dbEST wutblastn 1 -hitdist=40, -cpus=1 BlastGenscanDNA 1 wutblastn similarity
6 2001-09-04 17:21:19 Eponine NULL NULL NULL eponine-scan 1 /usr/opt/java131/bin/java -epojar => /usr/local/ensembl/lib/eponine-scan.jar, -threshold => 0.999 VC_EponineTSS 1 Eponine TSS
54 2002-08-12 14:52:26 human_swall_protein 1 TGE_gw 1 TargettedGeneWise TGE_gw gene
53 2002-08-12 14:52:26 human_refseq_protein 1 TGE_gw 1 TargettedGeneWise TGE_gw gene
1280 2002-08-12 14:52:26 other_swall_protein 1 similarity_genewise 1 FPC_BlastMiniGenewise similarity_genewise gene
1281 2002-08-12 14:52:26 combined-protein_cdna 1 combined_gw_e2g 1 Combine_Genewises_and_E2Gs combined_gw_e2g gene
1282 2002-08-12 14:52:26 ensembl 1 ensembl 1 Gene_Builder ensembl gene
1290 2002-08-12 14:52:26 refseq_cdna human_mRNA 1 exonerate_e2g 1 FilterESTs_and_E2G exonerate gene
1291 2002-08-12 14:52:26 embl_vertrna human_mRNA 1 exonerate_e2g 1 FilterESTs_and_E2G exonerate gene
49 0000-00-00 00:00:00 Pfam Pfam 1 /data/blastdb/Ensembl/Pfam_ls;/data/blastdb/Ensembl/Pfam_fs /nfs/farm/Worms/bin/hmmpfam 1 /nfs/farm/Worms/bin/hmmpfam Pfam 1 PFAM domain
40 0000-00-00 00:00:00 prints prints NULL /acari/analysis/iprscan/data/prints.pval /acari/analysis/iprscan/bin/OSF1/FingerPRINTScan NULL /acari/analysis/iprscan/bin/OSF1/FingerPRINTScan NULL Prints NULL PRINTS domain
41 0000-00-00 00:00:00 pfscan pfscan NULL /acari/analysis/iprscan/data/prosite_prerelease.prf /acari/analysis/iprscan/bin/OSF1/pfscan NULL /acari/analysis/iprscan/bin/OSF1/pfscan NULL Profile NULL PROFILE domain
43 0000-00-00 00:00:00 Signalp signal_peptide NULL NULL /usr/local/ensembl/bin/signalp NULL /usr/local/ensembl/bin/signalp NULL Signalp NULL Signalp annot
46 0000-00-00 00:00:00 tmhmm transmembrane NULL NULL /acari/work1/mongin/src/pipeline4anopheles/scripts/protein_pipeline/run_tmhmm NULL /acari/work1/mongin/src/pipeline4anopheles/scripts/protein_pipeline/run_tmhmm NULL Tmhmm NULL Tmhmm annot
45 0000-00-00 00:00:00 ncoils coiled_coil NULL NULL /usr/local/ensembl/bin/ncoils NULL /usr/local/ensembl/bin/ncoils NULL ncoils NULL ncoils annot
44 0000-00-00 00:00:00 Seg low_complexity NULL NULL /usr/local/ensembl/bin/seg NULL /usr/local/ensembl/bin/seg NULL Seg NULL Seg annot
42 0000-00-00 00:00:00 scanprosite prosite NULL /acari/analysis/iprscan/data/prosite.patterns /acari/analysis/iprscan/bin/scanregexpf.pl /acari/analysis/iprscan/data/confirm.pat /acari/analysis/iprscan/bin/scanregexpf.pl Prosite NULL PROSITE domain
71 0000-00-00 00:00:00 Superfamily Superfamily 1 /data/blastdb/Ensembl/sam/superfamily /acari/work1/mongin/superfamily/superfamily.pl 1 /acari/work1/mongin/superfamily/superfamily.pl Superfamily 1 Superfamily annot
1292 0000-00-00 00:00:00 SNPDensity \N \N \N \N \N \N \N \N \N \N \N
1293 0000-00-00 00:00:00 RepeatCoverage \N \N \N \N \N \N \N \N \N \N \N
1500 0000-00-00 00:00:00 miRanda \N \N \N \N \N \N \N \N \N \N \N
1501 0000-00-00 00:00:00 cisred \N \N \N \N \N \N \N \N \N \N \N
1502 0000-00-00 00:00:00 cisred_search \N \N \N \N \N \N \N \N \N \N \N
1503 0000-00-00 00:00:00 DitagAlign \N \N \N \N \N \N \N \N \N \N \N
CREATE TABLE `analysis_description` (
`analysis_id` int(10) unsigned NOT NULL default '0',
`description` text collate latin1_bin,
`display_label` varchar(255) collate latin1_bin default NULL,
`displayable` BOOLEAN NOT NULL DEFAULT 1,
`web_data` TEXT,
KEY `analysis_idx` (`analysis_id`)
) ENGINE=MyISAM DEFAULT CHARSET=latin1 COLLATE=latin1_bin;
1282 Genes were annotated by the Ensembl automatic analysis pipeline using either a GeneWise model from a human/vertebrate protein, a set of aligned human cDNAs followed by GenomeWise for ORF prediction or from Genscan exons supported by protein, cDNA and EST evidence. GeneWise models are further combined with available aligned cDNAs to annotate UTRs. ensembl transcript 1 web data 1
1503 new description new label 0 web data 2
1504 updated description \N 0 web data 3
CREATE TABLE `assembly` (
`asm_seq_region_id` int(10) unsigned NOT NULL default '0',
`cmp_seq_region_id` int(10) unsigned NOT NULL default '0',
`asm_start` int(10) NOT NULL default '0',
`asm_end` int(10) NOT NULL default '0',
`cmp_start` int(10) NOT NULL default '0',
`cmp_end` int(10) NOT NULL default '0',
`ori` tinyint(4) NOT NULL default '0',
KEY `cmp_seq_region_id` (`cmp_seq_region_id`),
KEY `asm_seq_region_id` (`asm_seq_region_id`,`asm_start`),
UNIQUE KEY all_idx (asm_seq_region_id, cmp_seq_region_id, asm_start, asm_end, cmp_start, cmp_end, ori)
) ENGINE=MyISAM DEFAULT CHARSET=latin1 COLLATE=latin1_bin;
469283 317101 30263615 30426490 101 162976 1
469283 317332 30811187 30929959 101 118873 1
469283 317348 31086734 31205532 101 118899 1
469283 317523 30451401 30562994 101 111694 1
469283 318770 30726577 30811186 101 84710 1
469283 319047 30562995 30708200 101 145306 1
469283 319456 30993469 31086733 101 93365 1
469283 339816 30426491 30451400 101 25010 1
469283 345105 30708201 30726576 1 18376 1
469283 368744 30249935 30263614 101 13780 1
469283 376992 31205533 31254640 101 49208 1
469283 469270 30929960 30993468 101 63609 1
469341 376992 1 49208 1 49208 1
469339 318770 1 84710 1 84710 1
469336 345105 1 18376 1 18376 1
469335 319456 1 93365 1 93365 1
469343 469270 1 63609 1 63609 1
469333 317523 1 111694 1 111694 1
469340 339816 1 25010 1 25010 1
469342 319047 1 145414 1 145414 1
469338 368744 1 13780 1 13780 1
469332 317348 1 118899 1 118899 1
469334 317101 1 162976 1 162976 1
469337 317332 1 118873 1 118873 1
469348 368744 657970 671649 101 13780 1
469348 317101 671650 834525 101 162976 1
469348 339816 834526 859435 101 25010 1
469348 317523 859436 971029 101 111694 1
469348 319047 971030 1116235 101 145306 1
469348 345105 1116236 1134611 1 18376 1
469348 318770 1134612 1219221 101 84710 1
469348 317332 1219222 1337994 101 118873 1
469348 469270 1337995 1401503 101 63609 1
469348 319456 1401504 1494768 101 93365 1
469348 317348 1494769 1613567 101 118899 1
469348 376992 1613568 1662675 101 49208 1
965899 965888 1 16571 1 16571 1
469271 965905 1 200 10 209 1
469271 965905 201 400 401 600 -1
469282 965905 1 100 701 800 -1
965906 469283 563 3444 31222465 31225346 1
965906 469283 397 562 31214121 31214286 1
965906 469283 100 396 31210077 31210373 1
CREATE TABLE `assembly_exception` (
`assembly_exception_id` int(10) unsigned NOT NULL auto_increment,
`seq_region_id` int(11) NOT NULL default '0',
`seq_region_start` int(11) NOT NULL default '0',
`seq_region_end` int(11) NOT NULL default '0',
`exc_type` enum('HAP','PAR') collate latin1_bin NOT NULL default 'HAP',
`exc_seq_region_id` int(11) NOT NULL default '0',
`exc_seq_region_start` int(11) NOT NULL default '0',
`exc_seq_region_end` int(11) NOT NULL default '0',
`ori` int(11) NOT NULL default '0',
PRIMARY KEY (`assembly_exception_id`),
KEY `sr_idx` (`seq_region_id`,`seq_region_start`),
KEY `ex_idx` (`exc_seq_region_id`,`exc_seq_region_start`)
) ENGINE=MyISAM DEFAULT CHARSET=latin1 COLLATE=latin1_bin;
1 469294 10000000 10500000 PAR 469283 30300000 30800000 1
2 469351 30500000 30599999 HAP 469283 30500000 30699999 1
CREATE TABLE `attrib_type` (
`attrib_type_id` smallint(5) unsigned NOT NULL auto_increment,
`code` varchar(15) collate latin1_bin NOT NULL default '',
`name` varchar(255) collate latin1_bin NOT NULL default '',
`description` text collate latin1_bin,
PRIMARY KEY (`attrib_type_id`),
UNIQUE KEY `c` (`code`)
) ENGINE=MyISAM DEFAULT CHARSET=latin1 COLLATE=latin1_bin;
1 synonym Alternate names for clone Synonyms
2 FISHmap FISH information FISH map
3 organisation Organisation sequencing clone
4 state Current state of clone
5 BACend_flag BAC end flags
6 embl_acc EMBL accession number
7 superctg Super contig id.
8 seq_len Accession length
9 fp_size FP size
10 note Note
11 positioned_by Positioned by
12 bac_acc BAC end accession
13 htg_phase HTG Phase High Throughput Genome Phase
14 toplevel Top Level Top Level Non-Redundant Sequence Region
15 _rna_edit RNA editing \N
16 _selenocysteine Selenocysteine \N
17 codon_table Codon Table Alternate codon table
CREATE TABLE `coord_system` (
`coord_system_id` int(11) NOT NULL auto_increment,
`name` varchar(40) collate latin1_bin NOT NULL default '',
`version` varchar(40) collate latin1_bin default NULL,
`rank` int(11) NOT NULL default '0',
`attrib` set('default_version','sequence_level') collate latin1_bin default NULL,
PRIMARY KEY (`coord_system_id`),
UNIQUE KEY `rank` (`rank`),
UNIQUE KEY `name` (`name`,`version`)
) ENGINE=MyISAM DEFAULT CHARSET=latin1 COLLATE=latin1_bin;
1 chromosome NCBI33 1 default_version
2 supercontig \N 2 default_version
3 clone \N 3 default_version
4 contig \N 4 default_version,sequence_level
6 chunk \N 5 default_version
7 alt_chrom \N 6 default_version
CREATE TABLE `density_feature` (
`density_feature_id` int(11) NOT NULL auto_increment,
`density_type_id` int(11) NOT NULL default '0',
`seq_region_id` int(11) NOT NULL default '0',
`seq_region_start` int(11) NOT NULL default '0',
`seq_region_end` int(11) NOT NULL default '0',
`density_value` float NOT NULL default '0',
PRIMARY KEY (`density_feature_id`),
KEY `seq_region_idx` (`density_type_id`,`seq_region_id`,`seq_region_start`),
KEY `seq_region_id_idx` (`seq_region_id`)
) ENGINE=MyISAM DEFAULT CHARSET=latin1 COLLATE=latin1_bin;
1 1 469283 1 100 50.3
2 1 469283 101 200 68.8
3 1 469283 201 300 32
4 1 469283 301 400 90.9
5 1 469283 401 500 88.8
6 1 469283 501 600 12
7 2 469283 1 100 50.3
8 2 469283 101 200 68.8
9 2 469283 201 300 32
10 2 469283 301 400 90.9
11 2 469283 401 500 88.8
12 2 469283 501 600 12
CREATE TABLE `density_type` (
`density_type_id` int(11) NOT NULL auto_increment,
`analysis_id` int(11) NOT NULL default '0',
`block_size` int(11) NOT NULL default '0',
`region_features` int(11) NOT NULL default '0',
`value_type` enum('sum','ratio') collate latin1_bin NOT NULL default 'sum',
PRIMARY KEY (`density_type_id`),
UNIQUE KEY `analysis_id` (`analysis_id`,`block_size`,`region_features`)
) ENGINE=MyISAM DEFAULT CHARSET=latin1 COLLATE=latin1_bin;
CREATE TABLE ditag (
ditag_id INT(10) NOT NULL auto_increment,
name VARCHAR(30),
type VARCHAR(30),
tag_count smallint(6) default 1,
sequence TEXT,
PRIMARY KEY ( ditag_id )
) ENGINE=MyISAM DEFAULT CHARSET=latin1;
3278356 162B08-6 ZZ13 1 GAAGCAAAACACTACAATGGCGGTGCGCTCGACGCGCC
3278355 198K08-11 ZZ13 1 TTTGATAATTTATTTCAGGCTCTGCGAGAATGAACTC
3278354 137M14-9 ZZ13 1 GCCTGTTAGATTCACCCCGGTCTCGAGTCTCTCTCTC
3278353 201K11-2 ZZ13 1 CCTTGAAATTAAGAAGAAGGGCTCGCCGCCGCCGCAC
3278352 151H04-2 ZZ13 1 GTTCAGTATGGTTTTCAAGAGGGTTAATTGAAAGAG
3278351 119K09-6 ZZ13 2 TGGAATCTCCATTATTATGAGCGCGCCGCCCCACTCC
3278350 187N08-1 ZZ13 1 GGAGGTGGATGAGAGGCCAACTCCAGCTCTCTCTCT
3278349 211G12-2 ZZ13 1 GGGCTGCGATTGCAGCTCACCCTTCGTTAGATAATCA
3278348 181D04-4 ZZ13 4 TTCTTTCTTTTTTAAAGGGGGTCACGGTCGCCAAACC
3278347 213E17-4 ZZ13 1 ACATGGGAGACATTTTGCCAAGGCAGCATCAAAAAAC
3278346 112H10-9 ZZ13 2 AGAGAGAGCTGGAGTTTTGGTAAGAGCATCCTAAGC
3278345 229D11-1 ZZ13 1 GGCTGGGATAGAGGAGGACGTCTCGAGTCTCTCTCTC
3278344 235I06-3 ZZ13 1 CGAGAAAAGGAGAGGAGCCTGCTGCCTCCGCCAGAC
3278343 191F14-10 ZZ13 1 TCCAGCTGCATGAGCAAGGGCCGGGGGCGCGTCAGACC
3278342 188P19-10 ZZ13 2 ATGGTTATGAGCTGCTCTGCGAGCGCGCGAGTGAGCA
3278341 224L18-4 ZZ13 1 GTGGCTCCAGGCATCCAGCATAAAATACATGTCTCAA
3278340 156G19-5 ZZ13 3 GAGAGAGCTGGAGTTTTTACGGAAGCTGCTGCCGCCC
3278339 189F08-4 ZZ13 1 CACGGCAATTCCTAGGTCCCGAGCGGAATAACAGGCCC
3278338 134O12-6 ZZ13 1 GGAGACTGCTGGGAGTCCTAAACTCCAGCTCTCTCTCT
3278337 219H13-10 ZZ13 1 TGCAGCCGCCCATCAAGAATGGGCTCTGGAGGCAGACC
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment